Description :
From Genome Similarity Track
Location :
Scaffold_344:9576- 10931
Sequence
1355 bases(100 bases per row)
CCCACGTGGGCTCGTCCTGATCCGCCCACTTGATCTTAAATTCACGCACTGAGCGTCCCGTTCTTGTTGACATGGGCATCCGATCATCTAGAATCTCCAA
CACTTCGCTTTCGCCGGCCAGACTATCAGGTTCCCAGCTGTCTTCGGGAAGTAGTTCCACGTCGAAGTCCAGCCGTGAGTCTTCGGTGATGTCAGGCGCC
AGTCGAGTCTTCGGCGGTCTTTGAATTCACTCACCGGCTTCAACCGCGAGACATGGACTACCGGGTAAAACCGATAGCCGCTCCGGTTCGGCAACTCGAG
CTCGTAGGTGTACTCTTCGACCTTCTTCTTGATCCGTAACGGGCCGTGCCAGCGGTGGGCCAGCTTCTTGGTCAGCCCCGGCTTGACACGTTCCATGTAC
AGCCATACGCGACTGCCCGGCTCGAATAGAGACATCGGCGCGTTGCTTGAGGGGTCTGAGTCCGCGTCCTGATTGGTTGGCGATGCTGTCGACGACTTGT
TCCTGCCAGTCGTCGGGATGGTTGATCTCTCCTTCCGGCTCAGTGCTTCGTTATGTTCGCGTGCTCGGCGGGCTTTTTCAGTCGCTTGGTATTCCTTGGC
CATCTCGAGTGCAATCTGGTGTTGTCGGTTGACGGCTCGGCGCCACGCCAGCGCGTCGGACTGTCTGCCACTGCCCCTGCGGAGCGAGGACGACATCGCT
TTCAACGTCGACTGAGCGTCCCATTCATGGACGAGGAAGAATGGAGTTTCCTTCCGGGTCATGTCTTGTGAGTTGTTGATCGCGAAGACCAACCGTTCCA
CGATCTCGTCCCAGTCCTGCTGAAGCGGGTCTTCGGCGTACACTCTCACGGATTGAATCACCGTCTTCACCGACCTCTCTTGCTGCCCGTTGGCTTGCGG
CCGATAACTCAGCGTAGCCCGCGACCTTGACTGCATCATTTCGGCAAAGGCCTGGAACACCTCGCTCATAAAGCGAGGTGTCTAACCAACGAAGGTGCTC
CGAATCGTCGGTATATACACTCTTCGAAAGCTTGGGCTACCTTGAGCGCTGTCGTGTCCGACATTGCCTTGGCTATCACAAATCCCGTGAAAGCACATTG
GAACAGGAGGAGGGCAGTGTTGCCTCTCCGAGTCATCGGGAGCGGTATTACGAAGTTCATGGACATAATTTGGAGTGGTCGCTCTGCCAACACGTTGCCG
GGAGAATACCCTCGCAACTGTGGTCGGCTTTTGCTGGTGCTGCAGTCCGGGCACGACTTCACATGCTTCTCGACGTCTGTATAGAGGCCGAACCAATAGT
AATCCCGCTTGACTCGCTGGTAGGTCCGCACTACCCCTTGGTGCCCGCCTTCTAG