Description :
From Genome Similarity Track
Location :
Scaffold_42:95745- 100121
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_08912Mitochondrial Carrier (MC) Family
Sappa_CBS223.65SPRG_08913zinc finger protein

Sequence
4376 bases(100 bases per row)
GATTTTTACCTCAGCGAGCACCCAGTGCACGAGTTTCAAGGGTCAATCAACAGTGTATTGACCCTTGTTTGTGAACGACATATAGCTCACATGGCGATGC
GGTGTCCGGGTTACCGCCTCTTCATTTCACGCAAGGATGCTCCATCGACACATGGCCACGTATGTTAATCTGCGTCGCTAGCAGTACTTGCTCGCTCCGA
CCGAAAGATGGTAGTATGTGTGGTGCGTACAACTGGTCAAAGGCTCGAGGATGGTTTCTTTAGCAACAACACGACGAGTCCTCTACGCGGTCTCGAGCCT
TGCTTAGCGCGTCGCCGTCGCCTTGGTCGCGCCACCGAGCAGCTTGAGAGTGAGGAACGTAATCTGCTCCTTGGTCATGAGCAGGAGCGCGCTCTTGAGC
ACCGTGTTGAAGAGCTGCGCCTCGCAGCCCTTGAAGAACCCGTGAAGACCGTCGGTGGCCCAAATGCGCTGCAGAATGTCCGTCATGCTGCTCTTCTTGT
CGTCGTTCTCGTCCGACTTGGCCTGCATGATGACCTTTGCGCGAATGATCGGGTACGTCACCACGGTCGCAATCGACTTGGCGATGGCCGCCAGCATAAA
CGCCTGGAGTGCCGTCAGCGACGTTGTCGCCGAGACCAGCTGGAGCTTGAGCCGGTCGAAAATCGTATAGTTGATCGCGGGGTTGGACACGAGCACGAGC
GACGGGATGTAGCCCTTCCAGAGGGCCAAGACGCCGTCTTGCTTGTACAAGGCCTGGAGCACGTCCCATTGGCTTTCGTTCGGGTTGCCGGACGTCTGGA
TGTACGTCGAGATGACCTCCCACGGCAGCGTCATGCTCATGTTGATCGCGCCGGCGAGCGCGCCGATCGCCAAGTTGGCGGCCGTCGAGAGCGCCCCGAC
CTTCTTCTCGTAGAATGTCTTGAGCCACGCGTACCAGTAAAAGTAGCAAAAGTTGGAGAGCACCTAAGAAGACGAAGAAGAAGCAATGAGGAAGCCTGGC
GTGGTGGACGTCCAAATCATCGGACCGTGTGGATGGCCTTGGGCCCGAGGCCGGCAAAGAGGCCTGCGACGCCTTCCGTGTCCCAGATCGTCTTGCAGAT
GGTCAGCGTATCGACCTTGCGCACCTTCGTCTTTCCATCGCTCGTCTCCTATAGCGCGAATGCATTGAGTCGGCTAGTACCGACGGCGACGAACCTCGGT
CGACTGGATCGACGCCTGGTGCTTGGTCTTGGCTACGTCCAACGGGAAGAGCGCGAGGCAGGCGAAGAGCGCGCCGACGGAGCCGGCCTAGGCCATGGGC
GTGAGGCCCTCCATGCGCAGCCGGGGCTATCCTGACGTACCGAGGCCTCGACGAAGGCCTTGTTTGACGCCATGGCAGCTTGTGATCTAATCCTAACCGG
TATGCAGCTGTTTGCGAAACATTCGAACTCGAGTCATCCGACTGAAATAGTGTACGTATACTTAAACGCGTTTGACGTGAAATGCGTTTTATTCTTTGCA
CCACACGCGTGTTCTCATGGCTGCCACGGCGAGGTTGGCAATCGTGAGCGTGCATGTCGAAGACGTTATAGCGATTAGCGCTTGCGTTATTTCGGTCTCC
ATGGTGCGGAGTCTGCTGTTGTCGCCAGATCAGAGAATGTGTGCGGCTAATCGCTGCGTCGCGGCCTCGAAGGTCCGGCAACACCGATTCCTGAACGCAT
TCGGCTAGCATGCATGCAGTATCCTCCAAGGGTCCATATAATATTTATGGACTTTTGGTATCCTCCTTGCGAGCAGTATGCTGCAAGGCGGCCGAGCGTG
ACCGTCGATCCAAACCCTAAACGCTGGCCATCGACCTGTTTAAACACGGTAAATGGCTTTAGTCCATGCTTTTCGCAGCGGAGCCCCATCGTCCCGTCAA
CAAGATTGACAAATCACTGGCCACCACTCCAGCCTTGTGAAGGCAACTGGAGTGCGTCGTCGCCAAGCCACAGTGTCATGATAGAGTAAGGCTGCACCAG
CGGAGGCCCTCGCACTTGATCCGACTACGGCAGCCACAGCATTCTGGACCTTCTGACTTGGCATAAAACTACTAGTATGTGGCGGAGGCGACGTTGTGAC
GCTGCTGGAGGACACCCATCGCGAAGACGCTCGTATGCGCGCTCAAGGTGAGGGAGTTAGACTGCAATAAGATCTCGACGGTCGCTGGACTAAGACGGTA
TGCACAGGATGGAGCAGATACCGACTCATGACGTGGCGTCGCCAAGGCCTGGTATCCGAAACACTGTTTCGTTGCTGTTGAAAACAGTGGATATTGACAA
GGATACCGTACCAACGACTGGTGGTACCAGTCAATTGCCAAGGGCAACAATGGCTTAGAGCATCACGAAGCGAGCCCGGGTGATGCGCACTGAGCATCAT
GCTACACCGAAAGCGTCCGGTGCGCACGCATCCAGCTACGTGGCGTTTCGGGCAGCAGCATGACTGTTTCGCTCATCATACTTCGTGCATCATATCTTCT
CAAGGTAATCAATCACGTGCAGAGGACAGCAGGACTTCTGGTTCCGCGATCGGCCGTCGTGCGTCGACACGACGACCACACGCACACAACTTTTGAAAAA
CCATGACGAGCCGTCGGTTGACGAGGCGCCCGACCAGCCAGGGCCTCGCCCAGTGCATGTACAGCTCGGCGGATTTGCGGATAACCTCACAGCCAAACAC
CTGTCTCGCGCGCATTTGGTGTTTCCCTGCGATGCCGTACAGTACAGGTACTGCCTTGTGTCAGTGTTCTGGTGGCGGCGGCCAACTTGTCCTGTTGAGC
GTTGACTAACACATGCTGACGTTGGGCGCGTCACGTGTAGACAGACCGCGTCTCACAAACACACACAACGCACATCCGGGTTCACGCTGCTAGAACCCTA
CGGTCGCAGGCCCTTTACACCACCGCTTCGAAGCGTTGATCGCTAGTCCTTCCAAACAATTGATTGTCCTTTGTGTACATAATGTCGTTGCGAATCCCAT
CAATATGTTGCACCGTGTGAGGTGTCTATGGTCGCGATCCAGTTTACCGTCGCGGAAATTGAAGTCGCTCGTCCAATCGCAAGCGACCTGTCATTATTTT
GTCCAATCCCAAGATGCCTTTTTCAGTGATTTCAGCCAATGGCATCGCGGCGAGAGAGGAGTTGGCCGGCCAAGTGCAGTTTGCGATTACTTCCCGACCA
GCAGCAGCATGCGAGGGTCCAGCGCGTCCGGGGCTGCGCTTCCCAAGGAGTTCTTCAACCGCCCCGACCTGACGCGCCAAGAAACCGAGTTCCTCGTGAA
CCTCGCCAAGGAGATGTGCATGGAGGTCATCTTCTACGCGCAAGAGAACGGCGGGACGGTCAAGTGGCGGCTCATGGAGACGAAAGCCGGCGTCCAGATC
TTCCAGGGCGAAGAGTTTGGCGGCAACGACGACCTCACGTACGTGTGCGGCGTCAACACGATCAAGGCCAGCCTCGCCGAGGTCGCCGACATCTTCAACA
TTGCCTCGGAAGAGAAGCTCGCCGAGTACTCGCGCGTCTTCGAACCGGACCTCATTGACATGCTCTCGATCTACGACCTCGCGACGCCGACGCCCGACAA
CCCGATGCACTACATTGGTGTGCGCTGGGCGGCCGTCGAGTCGACGTCGCCGCTGGTCCGGAACCGCGACTTTTGCTACCTCGAGGTATGCGCTTCGACC
CTCTCTAGTACCGTCGCATCGCATCGCATGCTTTGTAGTGCCAAGACGAGTTCGTCGATACGCGCACGGGCAAGCAGGGCTGGGTCCGCTGCATGCACTC
GATCAACATCCCGTCCTGCGTCTCGCTCGAGAAGACGCTCGGCTACGTCCGCGGCAGCTACTACCGGTCCGGCTTTGTGTTTGTCGAGACCGACAAACCC
GGGTTTCTGGACGTGACGCACATTCTGCAAGTCAACTTTAAAGGGCGCGTGCCGCCGTGGATCAAGCGCCAGACACTGCGCCAGCGCGTCCAGAGCATTT
CGCGCATCGACAAGCATTTCCAGATGAAGAAGCTCAGCGCCGGGCGCATCCTCGGCGACATTGACTTGCCCTCGAAGAAGCACGTCTCCAACTGCCACTG
GTGCGCGCGCAAGTTTGACCCGCTCTTTACACGCAAGTTTCGCTGCCGCAAGTGCGGACAAGTCGTCTGCAAGCACTGCAGCAGCCATTGGTACACAAGA
CTACATCGTACGACGCAGGACCGACGTCACGCGGTATAGGGATCTCATCTTGCCCTACTCGGGCGAGAAGCGCGTGCGTATCTGCACCATGTGCTCGAAC
CTCTGTCGCAACGAGTCGGACGGCGGCGACGACCGACTCTCCAACGACCAGTTCACGCCCGAGTACGTCCTCAGTT