Description :
From Genome Similarity Track
Location :
Scaffold_296:957- 2129
Transcript NameFunction/comments
Phyag_g4414conserved hypothetical protein
Phyag_g4415conserved hypothetical protein

Sequence
1172 bases(100 bases per row)
TGTGCATGGATCTACAAGACCTCACGAGTCAAGCATTTGGTACTCGCCATGTTACCACAACGGAAGTGCGCATCGGCGGCAACTGTCGTGTTCTTCGCGC
GTTTTTCCAAGACGAGCTATACGCTGATGCTGACTTGCCTGCACATCTCACTTTCCTTGGCGCGTAGGAGCAGCTATAGCAAAATAACCAGCGAGGTGGC
ACAAGATTTTTCCGAACTTGCTGTTCATATTAGTTGCCGTCTAAACAATTGTGTTGGCATGCCTACAGGTACGACAAGTTAATTGTGTACTGCGGGTCTC
GCTGATTGCGCTGGCGTGAAACCTCTGTGAAGATACGATGGCTACGCCACAGCGACTCCAAATACCTGTAACGAGTCATGTCTAGCCGAAGCGGGCGCCC
ACGTTGAAGACCAAtatcttcttcaccatggGAATCTACGTACGGACTTGGGAAGTACGCTGCCATGCTGCCGCCAACTACCGCGATACGGCATTGCTCG
AGCAGAAGTACTATACCCACACCACCTCCACACTCTGCGGCGTGGCGCGTGCATTCTCCTACGGGTGGTCCATGCGGCATGAAAGCACGGGTGCAACAAG
AGTCTCCACAGCACAGGAACTCACCACAAATCAAACAGAGCCCGGGATCGCAAGGTGCTTTCTCGCATCGTGTGCACTTCCGGCCGGCCATCTCGCTGTA
GAGCTCGTCGTATTGGATAGGCAAGTCAATCAGTCGCGGTCGCGAAGGGACTTCGCGGAGGACGAACATACTAGCAACGTAGGCCTCACTGCAGCCTTCA
GTGTGCTCGCATTTGTCACCAACCTTTGAACTTCCCAGGTGGGTCTTGCTGAGCATGCGGTCAATGCACCATCGCCAGATTTGGTCGAACGTAGCGTCTG
AGCTGCGCGCAATGTCGGCCAACGTTGGAATTTGCATCGTCCTCGTACTCGGGGGCACACTGGAGTCGTCACTGaccaagcagcgccagaAAAGCTTCAT
CCGGCGAACAAATGCAGCATTAGAAGGCAAAATGCGCCTCAGCCGCGCATTCACCTCGGCTACACTTGTGATTGGCTTCAGTTTTTCAGAAGGATACGCC
TTAGCCATTCGCTGCAAGAGTTGTAGTGCCGCATACGCTTCCGATTCTCcctcgccagcagcttccaccgtT