Description :
From Genome Similarity Track
Location :
Scaffold_40:956955- 959660
Sequence
2705 bases(100 bases per row)
CACGGCACTAACTTCATCCGTCGTTCCACTTTGAACATTTACACCAAAAGCCGATTTTGGAACGAGGGTCACCGCAGCCACATACGCACCCGATGGGATT
TCAACTTCTTCGGTAGACGCATTGCAGACTTCCACTAAGACAGTTCCATTCATCACCGTACACAAGGTTCTGACAACTCGTAAGTTCTCGTCCGTTCCAG
GAACGCCTTCGACCAAAACTGTGGAACGATCTTTCATCGTTCCCTGAACTTTAGACTTGACTAGAGCTAAATGACCCGGCTTCAATTGCACAGTCGAGGT
CACCGTGGCGGCATAAGTCTCTTCTACTCTCGTGACGCCCAGCGGGATTACATCTCCAGTTCCCTTCAGAGTCATCGATTGATCCTCGAGATCGATAACG
GCACGGAACGAGCGTAACGAGTCCGTTCCCAAAATGGCATCTACGAACAAGTGGTCGACCACTACGAACGGAAGCGTCATTTCTATCGTTCCAAGTGTCA
CAGGAAGGTTAATCACACCGCGTACGCGGATCGCATGCCCCGAAACACTATCCAAGCTTCCGCTATAGGGTTTGAGAGGTTACGACGCCCTGCCGAGTCG
TACCAGCACGCGCTGATTCACGAGACTCGCAATGGCCCCAGTAGTGCAGATTGCATGGGCAGGTCAGCCAAGTTTGCGTCGAAGAGCACATCAACGGACG
TGATGCCCGTATATTGGGCCACGACGAACGATTCGCCAGTGTTTGGCGTCAAAGTAACGAATAGAGCTGGTTGGCCGTATCGCGTCTGGTAGGCAAATGC
GCGACGACGGCACTGCGCTCGCTCGGCGTCGCTTCCCCAAATTACACCACCACTGAGCTCGACTGTATTGAGAAACTTGCTAGCGGTAGAGGAGATGTCC
TCATTCGATGTCGTTCGACCTTGGCGGCGCAGCTCTTTCTGCTGGAGAGCTTCCATTAACGATTCTTCGGTAATACTTCCGAAGTAGCACTGTAGGATTC
AAACAAGGCAGGATTGTGCTTGCATTTTAGTGTGACTTGTAGGTACATCTTTTGGACGGAGAGAAAATGAAAACACACCAGCATGAAAAGCTCGTCTTCA
GCATCCCCCTTCGCGTGCTCAACACACTGTAATGATGAATGCAGGCCTCTAATGATACTGGAACGACCCACTCCTAGTTCGGATGCCCTCGGCCATACGG
GAAAAGGTGAGGGAACATACGAGCGAATAATGACTTGTCGCTCACGGAAAATCGGCTGGAGTGACGAACTAGTAACTGCGGTTGTGAAGAGCGCTGAGCC
GGCAGTTCCTCGACACATACAGCTGCTCGTGGGGTGTCTTGCGTGCTGACCCCACGATCCTCAGAAATGAAGACTACTCGACGTTCAACAACGACAGTTT
CTGCGTCAGAATTGTCGAACTCGGCGACTCCGCCTACACGATCGCTCTCCACGTCTATACCATCAGCGTCAATACTGGTATTCTTCTCCTCCCAAATCAA
GTGCTCCGGTATGATTTCCACTGCAAGCTCAGAGCAATCCACCACTATATCCTCGTAAATAAATTGTGCTCGCGATAGAAAGCGAGCAAGTCTTCGACAA
CGCAACGCCGGACGAGATGCATTTGCCGTATCCAAGCTTGCTGCTCTGTCGTAAATGGCCCAGCCAGAACCACACGGTATTAATACGACGTGCTGCCATG
ATGTAGCGCTGGTAATAGCATTGCTGCAGGACCGGGAGTTGAATCAAAGGCAAGGCAATGGGATCGGATACAGCGATGTGCTCCACCACGCATGACTCTC
GTAACGGCGACAATTGATACTGTCTGCGTCATTAAGTGTGCGTACTGGTAAATGGACTTCAATACGATAAAAATTGACTTTGTATCGCAGCGACAATTGA
ATCGATTAAGATGCTCTAAGAGCATCTCCACCGGTCGGGACTTAACCTAAGTCTTAAATGAGACTTTGAAACCCCAAATTAGAAAATAAGACTCGAGCTC
AACAATAGCCTCCAACGGGGAGACTTAAGGGAGGTTTTAACCTATAGTTTCTGCCATTCGCAAATCGATCAGGTAACAATCCGATATAAAAGCCGTTTGT
ATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCACATCGTAGCATCGAATTCATCGGTTACACGTGCAATCTTAATACTCTACTCCTCGAGAGGCTACGCAGTTTCTCGACTTCTGGACAGTTTGT
CACGCTATGACCCGGTTGTCGACAGAAGACGCACTCCTGAGTACGACGATCTCCATATCGACCTCCACTCGCCCTCCTGGGCAAGTTACACTCCATAGAG
TAGTGACCAAACTTGTGACAGCGATTACAATAGCCTCTCGCACGAGGGCACGTCTCACGACTGCATCCCTTACGCTCGCAACGACCACACACGACTTCAC
CTTCC