Description :
From Genome Similarity Track
Location :
contig_148:9567- 11984
Transcript NameFunction/comments
g11709.t1hypothetical protein

Sequence
2417 bases(100 bases per row)
ACGAAGAGTGCCCGTCACTCTTCCGGGTTGGGTATATGGTGTACCCAACACCAGACACGTGGTGGTGGCCCACAGCCACCCATACATAAAACATATAGGA
TAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAACCGTTC
CCCAAGACCGGGAACTAGTGAACCGTCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCCTCGAGCGCAAGGTGCTGTGTGACTCCCGTCACACTTGGT
AGCACTTGTAGTCAATCCTCGCCTACGCGGGTAAGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAGTTTCCT
CACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGGCAGCAACACCTGCCGAGCAGC
TCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACGGAAACCAGTTCAGCC
CAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGGAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTCGAGCTCGCTATGGACGCGGCTCTC
GTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGTGAAGCGACAACGCCTGGATGCT
TTGCATCCTGGGCTCAGCTGTGTGAACAGCTTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTATCGCCAGCGCTCACGCTTCCTTGCGTGCAAGCAAGG
GAGACGTGAGCTGCACGAGTACATCCAGGAGATGCGGGAGCTCACCGCATCTCTGGTGGGAAACCCACTCCATGAACACATCAAGGTGACGGTGTTCATG
GACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATCGCTCTTCAGGAGGAGTACAGCC
ATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTCCTGTGCCGATGGACCTG
AGCCTTGCCGAACAGCACGACATTCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAACAACACGGCGGTTTCCTC
CCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCGCGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAT
CTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGAGGGCTGC
TTGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGCCGCCGGACGGTCGCTCG
CAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGTAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGCCCAAGGTC
TTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCATGCCATGGC
TTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGCTGCTACTGACAGAGCATTGGTGAGTCATGTTCCCACCTC
TGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAATGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCATGACACCGTCCACCGGG
CAACGGACCGCCACAGGCAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGACAGCAGTACCCACCGCTCCTGACTATGGCACCGTA
CGGCCTTCGGCCTTATCGACGCCGGGGAAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGAGGTCGAGACCGTGGCCAGGGTCGAGGTTG
CTGGGAGCACCTCTGGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGGCTGTGGGTAACAAAGGACC
ATGCCGTGGTGGGCATCGACGACGTCGTCGCCGCCGTAAGCCGAGTCTGGTGAGACAGACTGGAGTCGCTACAAGCGACTCGGAGAGAGAGAACTCTCCT
CAGGCACGGCCGGCCGA