Description :
From Genome Similarity Track
Location :
Scaffold_62:95617- 98841
Transcript NameFunction/comments
Sapdi_VS20SDRG_13644hypothetical protein
Sapdi_VS20SDRG_13645hypothetical protein

Sequence
3224 bases(100 bases per row)
TCTTGCAGCTGCTGCGACATGTCATCGGTCGCTTTCGCCTGGAGCTTGAGCTTGGCCTCGAGCTGACTCGTTTGTGCGTCGAGCTGGTCGCGCTGCGAGG
CTTGTGCGGCGTCCGCTTCGCTGCATTTCTTTTGTGCAAGCGCCAGTGCTGCTATAGTCTCGGCGTGGACAGCATTCTACACCTTAGCATGAGCGATGGC
GTTGCAACAGAATGTTCGCATACGAGGTCCTCGACAACTTTGGCGTGATCCTTGGCTGTTTTGAGGGCGTCGTCTTCGAGCTCCGAAATGCGCTTCTTGA
GCTTCTCAAGCTCGCCAGTCGAGTGCTGGAGTGTAATGTTGGTTGCTTGGCGCAGCAAGAGCTGCTCCTGCAGCGCTTCCACCTAACCGTTCGGTTGAAT
CTTGCTTTATGCAAAGCACGCCAATACTTCGATTGCATGCTCCTTCTTGAGCGCTGCGAGCGAGTCCTCGCGCTTTTGGATGGCGCGACTGTGCTCGTCT
TTGGCTGTTTCGAGCTGCGCTTGCGCCTCGGCTATTTCTTTGGTCTTGGCGTCCACGTCAGCGCGAAGCCCGTCGAGGGCACGGGACGCGTCCGGATCGC
CCTTTGTTGTCTGCGCCTCGAGCGCTGCGACCTTGGTTTTGAGCTCGTTGATCTTCATGCGCAGGTAGTTGGCTTCTTTTGCTTCCGTCTCGGCGGCCTC
CTTTCCCCGACGCAGCGTCTCGTTCTCTTGGTTGAGTTTGTCACGCGTGGTCTTGGCTTGCTTCTCAGCCGTCTCATGGCTCTTTTTGAGCTGGGCGATC
TCGGCGCGAAGGGTTTCGATCTGTTTCTCGGCCTCCTTGTTGGTACTCGTAGGTACGGTGCTGCCCATTGTCTTGATCGCTGTCGTTGCCGTCGTTGTCA
CTGTCGGTGCCATGGGCGTCGAGAGCAGTGGCGTCGGCGTCGGCACCGCTTTCGACACTACCGTGTGCTCCTCTGTCTTTTTGATGGATGACACGATGCT
AAAACTTTTGGGCATCGGCGTTGGCGACGGCTAATGCGATATAAACACTCGTTGACAGGCAGATGTACATACCACATCAAAGTCGTCTTCGTCGTCGAGA
AGCCACGCCTTCGAGTCTTTCCCAAAGGCCGATCCGGCGCTCGTGACCGGCGCTGGCTTGTTGGAAGTGATGTCTTCGATCGTGTCGACCATGTCGAATT
CATGCACCGACGTCTGGCGCCGGCCGAGATCCTTCTTGGGCGCGCTATTGAATGCGAGCTTCTTGGCGTCCTCTTCCTTCTTCTTCGCAATCATCTCCTT
GTAGTGGCCGTCCATCGGGTGCTCCCAAATGCTCTCTTCACTGTTGACGTTGAAGTAGTAGATCGTGCCATCGTCCGTCTCGCCTACGACAGACTTGAAC
GAAGTCCATCGCCACAACCACAGAAAAACCTTGCTCCCAGTCGTCAGGTAGCGGCGCTGTTAGCGCCTCCTCCACGATCCAGAGATATTGTGCTTCTTGG
ATCGGGTCGAGTCCCAGCGTCCGCGCATGTTCGTGCAGCGCCTCCTTGTACTCGGGGCTCGACTTGTCCATGGCCCCGCAGTAGCCGCCTATTCATAGGC
GACCGTTTCCTCACCACCGTCGAATGCATTGATGATAGCAATCCTATGTTGTCCGTCGCTTGTGTAGTTACATTCTTCCATCGTGAAGTTGGAGCTACCA
AGACGCTCGACGCCTTCGTGCGACCTCTCCCCCAAGTAGTCTCGTGCCCGAGCACGCATTTCATACCTTCGACGATACAAAGCTTCGGCCGTGACTGCAC
GTTACCGACAACCCGACAAACGTGCAGTGCATGTGGCTGCAATAGTGACAAGCAAAAGTCACCAGTACTCAGCGACTCGATGAAACGTGGGGTTCATGCG
CGCAGCGTGCTCGGCGACAACAAGGCTCCATCCCGAGCTCAACGCACGAATGATGATTGCAGTTGTCTCTTGGCTTCCAAGTCAAGAAATACGAGGTCAA
CGGTATCGGTTACACTTGTTTTCTGGGTGGCGGAACATGCTCCCATGCCTCGCACCTGCCCCCAAAGCTCTGGAATCTCGCGCGCCATCGCTTGCGCACA
CGGACGCTCATATCGACAACGAAGTCGCTCGCTTGCGCAGCTTGCATATCGCCGACGTTCCGCGCATGAGCGATCTTAGCGTCTTCCGCGTTCGCCGCGA
CGCCCTTGGTACGCCTTGTACGATAGAGAAGGCACTATTCACCGGCGGTCTAGATGTCAGTGCAACGGGCCGCTCGACGCTCTATACATTGCAGAAAGCT
CGACTCGAGATGGAGCGACGCCGACCTGCTTCGTTTGCTTTTGCTTTGCCGCCCTCCGCCCTGGAGCCGTCGCCTCGTCCATCCCCACGCTTTGTGGCAC
CCGTCGTCGCATCACCGCGAGCTTCCGTGCAGGCTGAGCCACGAGCACCGATGCCAACTCAAGAGAGTCACGGCATCAACACCAGTCCTCGAAGGCAGCA
CTATCACGTGACGTACCGCGCGAATGCATTGCAAGCTCCAGAGAGCGTCTGCACGCACAACGACGCGGCGCATAGTAACAACGACACGGAACGGCAACGA
CCGCGGCGAAGACGACATGTCAAGTCAACGCGACAGCCGCAGTTGTCGTGCCCGCTGCCAATCAACCCGATCGACCCGCGGGACCGACTACTGCAGCTCC
ACGACATTTCCGAGTTTGACTTGCGCGTGTGCCACTCGCCGCGGGCCGTGACCGCGTACCACGGCCACCTGAGCGACTACAACCTCGAGGAGCTCATGGC
CAAAACGGGATTCACGCGGCTCGAGCTCTATACGCTCTGGAGCCGCTTCAAGGCGCTCTGTTCGCTCTCGCGGTCGCCCGCCGGCGTCGACCAAGCCACG
TTTCGGCGCGCCGTGCCGCTGCTGTCCGTGGAGGACGAGATGTTTGTGGACCGCGTCTTTGCCATCTTGGATGACGATTACTCGGGCGTCATCGAGTGGC
GCGAGTTCATTCGCGCCATGTCAGCGCTCGAGAAGGGCGACTTGCGCGCGCGGATCGTGTTTTTGTTTGAAGTTTACGATCTAAACGGCGACGAAAAGCT
CAGTCGCGACGAACTCATGGCGTTCTTCATATCGGGCCTCATGGTTTCGTCCGACGACAAGAACGTGCAGGACATGGCGCAGCACTTTGCCGACGAAATC
CTCTTGGCGCTGGGCGTCACGCCG