Description :
From Genome Similarity Track
Location :
Scaffold_191:9561- 13992
Transcript NameFunction/comments
Phypl_g4994hypothetical protein PHYSODRAFT_476935
Phypl_g4995hypothetical protein

Sequence
4431 bases(100 bases per row)
CGACTCGCCCGTGCCCATTGGTGCCACGCCCGAGTACCTGGCGGGTCACTAcatgctgcagtcggcgtcgtcgatctGTGCTGTGATGGCGCTTGCCCCG
CAGATGAACGAGCGTGTCCTGGATATGGCTTGCGCTCCTGGCGGTAAGACGACCTACATTGCCCAGCTCATGAAGAACACGGGCTCGATTATTGCGAAcg
acctgaagaagcagcgtctCAAGGCTACGGTTGCTAACCTTCACCGTCTCGGTGTCAAGAACACTTCGGTGTCGTGCTACGATGGCCGCAAGGTGCCGAG
TCTGTTTAAGGGATTCGACcgtgtgctgctcgatgcTCCGTGCACGGGTATGGGTGTTATTGCCCGTGACCCGTCTATCAAGAcgcagaagagcgagaag
gacgtTCAGCGCCTTGCTCACttgcagaaggagctgctgcttgctgccatTGATGCTGTGGACGCGAAGTCCAAGACTGGTGGCTACATCCTTTACTCGA
CGTGTTCCGTCATGGTGGACGAGAATGAGTCGGTCGTTGACTACGCTCTGCGCAAGCGCTGTGTGAAGCTCGTTGACACTGGCCTTGACCATGGCAAGCC
CGGCTTCACCcgctaccagcagcagcgcttccaccCGTCGGTGCAGCTCACTCGCCGATTCTACCCGCACGTGCACAACATGGATGGCTTCTACGTGGCC
AAGTTCAAGAAGTACGCGAACACGATGCCTtcggaggagaaggacgccaAAAAGACCActgacgagctcgaggaagaggccgaggaggccaGCATGACCA
AGAAACAGCGTGTGAAGGCCAAAAAGGAGCGTAAGcaggcggccgaggacgtTGAGGCGGAGGTCACTCTGGAGGATcagagcgacgccgaggaggaaga
caaGGCGACCAAGCGGCCTGCGAAGAAGCAAAAACAGGAGCCCAGGCCCAAGAATGGCAAGAAGCACGCTGGCAAAGGCACGAAGCCCAACCGGCCGCGC
AAGAATTAgacagcacgagctggtgctaGGAAGGCGGCACTTGGAGCTCGGTTCCAATTGTCCTTCAGGGGTAATAGATAACTTTTTTGTTTTGTTCATT
GTGCGCTTCGTTGCCGCTCTTGATACGTCAGAGTCGCTTTGTCAACTTCAAACAGCTTGATGTGGTTCCACACGCGACAGGCAACGTTCTTGCAGCTGGT
GAACGCGTCTCGGTCCGCACACGCAGTACATGCAACTTCCAAGGCCATCACCGCTTTCTCGTgcctcgtggacgccgtgtGAATCGCTAGGAGACTTCGT
TGTGGATTGGCGCTGCACTCCTGGCACAACGTATCATTGCCAATTGATCCACACAGCCGGCAGTGCTTGCTTAGGTAGAACGAGTCAATGGATCGAAAGC
CGCGGCCAAACGGCCGCTTCGGCGTGGCGTTGTCGTACACATGCTGGCGAGCTTTCACGGACGAACGAGGCAGCGCCGCGTACCACGACCGAATGTTGGC
ACCCGTGAGCAGGAAAAGTCGCTCCAGACTCGGGATAATCTGCAACAAACAACGTTCAGCGTTGGGTTGTGGttgcaactgcagcagcaacatccgTACC
TGTTTGTTGATGTAGTAGTGGTAGTTGATGCTGTACCGCTTCCGCTTGTCAAAGTACTCATCGGGTGATACCACCAAGTCCATCAGGCGCGCACCGGGAG
GTCCGTTCACCACAACATAGGGCACCCGTTCTGCATACCGAGGTTCTGCTCGTGGATCTTTTCCCATGGTTTTAGCGCTGACGAGTGCTGCAGGAGGGGC
ACTACAACATACAGGGTCAGCCATCGATACAAACAAAGTCTAGGAAGCGACCATGCTGAACTCAGTCCCATACCTTCCGTTGCTGTACGTCCCCAAGCGA
ACCTCTTTCGCAAAGATGAATTCTTTCAGTGGCACACGGTTCTCCAAGATCTGAAGCCAGTACTTCTCCATCCCTTCTTTCACCTTGGACAAGTCGCTAG
ACGCAAAAAGCGTCTCGAGAGAGGCCTGCATAGCGTGCTGAACGACACCGCAGGAATCGCGTCGAACCGTCTCAAGACCCTTTGATTCAATGACGCCAAC
TTCTTGTGTCGAAGACTCAAACTTGTTGCCCACGTACCGCTTCTTGGATACGAGAACACAACCCATGTAAACCTTCTCCAACTTCAATGTCACTGGTCTG
CAAGCATGAAGCCAGGATGTCAACCAGAGCCGCAACCAATTGTTGCGAGAAGTGTTACCTTGGATTCGATGCGGTGACAGCGTCAGCGATTTCCTGACCA
ATTCGAAACGCATCTGCTTTAGACCTCCCCTTGAGCAACACGAAAACACTGTCCGTATCGCCGTAGACAACCCTGGCATTCCAGTCTGCCCGTCCTTCTA
TCAgtcgaacagcagcttcaagcgtGCATCGTCCAGTCTAAccgcaaaaaaaaaacacgaAATACCGAGAATGAGTTAGTTCGGGCAAGAAATAAGGAGA
TGAACAAGGCAGTGATCCTAACCTGAACAATAGCATCGGCCAGTTGAGCGCACGGCATGCGTCCCGAAAACCCAGCCGCCGTGTACCCGTACGTCACGTT
TGAGATCATTTTCAGCGCTAGCTGTCGAGCATTCAGGACCTTCTCCAGGCGTTCCTGATTGGACTCCTTGGCCGATTTCATCGATTTTTTCACCATGATT
CGAGTCGACAAGATTTCGTCCAAGATGATAGGGAGAACCCCATGCCGAAAACTCTTGGGACAGAACAACGTGCCGTTCGGCGCGATAATTACATCGTCTC
TGCACTGCAAGAGCCCAGAAGCGCTGGGAGAAAAATCGACCACCCCGAGCGATGGCTCCAACTCGGGATTTAAGCCATCCTTCAAGCGACCCAGTAAGCT
GGAATAACACAAATTATACCCGATCACAAGTGACGGATAAAGAGACTACGGATCACAGACGACGTTAACAAGGCATCAAACCAGGCGACACAAATAAAAT
CAATAGCGCACCTGGAAATCAAGAACCACGACGGGGTCTGGGTAAAAGCTCGAATGGGGTTCCATCACAAGTGGAATGCACTCCATCGGGGCCTGACCAG
CCACTTGGTTTCTGCTGGGTGATACCAACAGGAAATTTTTTCGCTTCGTCACACGTAGCATGACAGCCTCCACTCGGTACTGAGATCCCCGAGACAAAAC
GGAGTAAAAGTCGATCCCAAATAGGCGCGCCATCTCGCTGCGTCGATGAGCGTCACAAACACACGCCAGTTAATATGGTGCCACGTGACAAGATCAAATG
AAATTAGCGTACCTCGTCCTTGTGATCAACTGCAGTTTAGCGATGATTTGGAGATTGAGCGCGGCTCGTTCCAAATAGTATCGGATCACCTTCCAGCGTA
TTTGGCCACCTCCCTGGAACCATGCCGTCAATCTTTCAGACGAATATACGGGATAAGTCCGCTTTAGGACCGCCCACACAACATCTTCAAGAGCGTAGCG
CGACAATTTCAGCTGATGCGAGCACACAAGTTACACCGTAAAAACTCTGACAACTAGTAGCTGGAACGAAGAACAACACCCGCCGTACCTCAGATCTAGC
CATTCGCCAGAGGTTGAGAATGTATCTGCCGTGGAGCCATAGCCCGGCCGCCTTGTTCACTCCCCACATTGTGCCGATAGATGCTTCCTTTTGGCTCTCA
CCCTCTTGGTCCGGAACGGTGGTCGTATTTCGAGGATCTATCGGTGTCGACGGAAGGCGGGAAAGAGACTGAATAAGGTTTATCTAACATTTATCGTCAC
AATGAGTGAGAAGTGAGCTTGTGACAATAAACAAAGCAAAATGAGATACTCACATCCATTTGCGATGCTCGATCGACAAGGTATCCAAAGGAAGCCTTTT
GGACTTCAAATCCTGCCAAGAAGTCTGGGTCCCACCGCCTTATTAGCGCCTCCAGTGaacgaagaagttcgcgcTCATCTGAAGCAATCGTTACCGATAT
atcgctgctgtccacgcGTAAGCCCACGCTCCCGAGGGTAGTCTGGTCCATATCATCCGGTTTTAACATGAGGAAACCGCGTTCTTTTGTCTTGGAATCT
GTTGGCCCCTCTTGAGCTTCTACTGCGTAGCATATCACGTTGACCGGGTCGTGCAGCGGATTTGGGAGCATGTTGCCACGCGATGCAGCAAATATTTCGA
TGGACAGAATCGTGACATTTGACAAGATGGTCCGCGAGCTGAGTTTACTcgagggcgacgccgtcgacgcaAGTGATGGTCGAGCACGCTTGTGTCGCAC
CTGAATAGGAATGATGTCAACATATCAGGGATAGTGTCGAGGCATCACCGCAGCATTCAATCTCGCACCTTGGTTGGAATTTGAAGTTTCTTGGCATCAC
TTGACACCCAAGCTTCGACAACAGAAGCGTC