Description :
From Genome Similarity Track
Location :
Scaffold_831:9561- 13282
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_831-snap-gene-0.6Protein HIRA
Pytiw_DAOMBR242034snap_masked-piw_contig_831-abinit-gene-0.10RhoGAP domain-containing protein
Pytiw_DAOMBR242034maker-piw_contig_831-snap-gene-0.9Conserved gene of unknown function

Sequence
3721 bases(100 bases per row)
ACAGTGTAGAGTCTACAGAGGAATGAGTTGGGTTGCAAGGAGGGTGGCTGGCGATAATAGAGTGTTGTACGCAGGAAGAGTGAACAATGTCGCATCTGCT
CAAAAATGCAGTGGTGAGTGATACGAGTAAAACTATCAAAAGCTGAGCCTCAGGAATGAAGCAGCTATCTCTGACCTCCGGCATCTTCGCATGGCAATCA
GAAGCAGGTGCCGAATCCCATCCGGAAGGCACCTCTCGTTCGGTGACCGGCCCGCGGCGTCTCCATATTAAATTCGCGTCGATGAGCTGTGACAACCGCA
CCAAACAAAGCCCACTGATTGAAACCGAGCGCGTGCTGGACGGATCTATTTCCACTGTGAGTGAGCAGGAAGCGTTAAGGAAGCGTTGAAGCAAGCCAAC
CACCAACGAGCGAGTGACCGCCTGGACCAACACATTTCGCAACGTGCGCGATTAAACAACAGTAGAAATGAGGTACGTGGCTGCGCTCGAATTGTTTTGA
GCTACTTCCACTGTCAAACTTTGTGGCTCACATGACATCACTTATGGCTTCAGCAGCGAGGTCGTCGTCTACACTACGATCGCACTCGTGTACAACGTGA
GCAGCAACAGCCCTAAGCATGGAAACGATAACGCTTCGTCTCAGCGCCATTCCGCCCCGTCTAGTGTCGACAAGCGAAGCGTTACAGCCAACAGCAAAGG
CATTAACAGCGACGAGCTCGTGGCAACGATGCCGTCCGAGCGTGCACACAGCTGCTCATCTATTGATGCACACGGAGCGCGATGGCGACCGGTCGCGAAC
GGCGCGTGGGCGCAAATCCACCTGTTTCTCGAGATGGAGCGCGACGACCGTAGCAATGTGTCTCACCAGACGACACGAACATCAGAGCCGCGCACCTCAA
ACTGTCGAACCCACCGAAGCGCCTCCGGCTTTGGCAGCAGCCTGAGGAAAAGCAAGAGTGTGCTCAAGAACTTTCGCATCGTGGCGTGGATCCTCGACAC
GGGCCGCGTGATTGTCAACGACGTGCTCGTGAAGGGCTGCAAGTGGGAGAAAGTGGACTCGTCGCTGCGCAGATTCACGGGACTCGACGGACTCACGGTC
TACGGATTCGGGTTTCGGAGTGAGACGCAGGCAGTCGAGTGCTCGCACATCATCAACCAGATCCTCTCGAACGTCAAAGGTATGAACTGCTTATTTGCAG
TGTCTACAATTGCTTTGTGGATGTCACTGATTAACTCTGTCGGCTCCGACAATGTTGACAATGTTGCCCAGCTATCACGCGCTTGATCAAAAAGTATTTT
ACTGTGCGCCCCAGCACTCCCAATGTACGTTGGAAACGGTTGAGCATGACTCCCCAACAATGTCTAACGGGTGTCTGTGCTTAGTACTTCTCGAGGCTGC
CGGATATGCGGCTTCTGGGATTCGATCGCATCCAAGCCTCTCATGCGCAGCAAGTATGTCTACCATTTTCCCTTCTACATGGTTGAATCATAGAGTTCAT
TGTCACTTTATCACTGCTGTATGTAGACTGCAGAGGACGCCCAGTACAAAAGTGCTGATCCCAAAGCCGCCAAGGATGTTTGCAACCGAGACACCTCAAC
GATCGTGTATCCAAAACTGCGCGCCCTCAGCAGCAGCGGCAGCGCCATCGACTCGGAGAGCGACGACGACCTAGACTCTTTCACGAGCATTGTCAACGCG
TCGTACGTCAAGAGGACCTCGAGCCGCCACCTGCTCGCGCAGTTCACCGAGGTAGAGCTCGCAGCGCTGCAGCAGACTGAAGTCGCCAAGTCGCTCGAGC
AACGCGAGTACCAGCAAAACGACAGAGTTGACGTTTCGTTTACAGAGATGGTCTCTCAGATGCAGAGCAGCAAGCTGGACCTGGTCAACGGCGCCCTTGC
TGTTGTAACCACAGAAAACGACAGCGAGAGCTCTCCAGAGGCGGATCACAATGTCGAGAGCGACCACAAAGCCAGCGACGACGAGTACGAGCCACAGAAC
AGAGACGTACTGGAGGGGAAGGCAACTGTACCGGAGGCCGAAGTCGCCATCGACAACCAGGTGCTAGCCTCAGCTCACGATGACGTCTCGTCTGCGGACA
AGATCAGTTTCCCGTTCAAGACACGGCAGGAAGTCCACATCACGTACAATGTGAAGCACGCGAGGTACGAGGGACTCCCGGCGGCGTGGCGAGTGCTCAA
CCACCAGTTTGGATTGCCGCTGGAGGCTGTGCCGAAGCGCACAGTCGATGGCTACGAGGCCAAGATCCCCGCTGTGCTCCAGATGATGAAGGAGTACTTG
CTGGTGAACAACGGCACCACACTGGAGGGGATCTTCCGCCTCGCCCCAGATAAAGATCAGTGCAGCGCTGTCAAAGAGGCGATCAACAATGGCACGTTCA
GCGGATGCTCGGACGTCCACATCATCGCCAACCTGATCAAGGTCCGTCGAGCGACCCTGTGGTTCTATTGGAGCTATTGGAATCTCTCAACTGACCACGC
TGTTGTGCTTTCTAGGTCTGGTTTCGCGAGATCCCGCAGAGTCTGTTCAACATTGTCCCTGTGAAGCACATCTACGCCGTGTGCGCGCTAAAGGTCCGTG
ACATGTTGGTAGAACTCCATCAAATGTTTATAAAAGCCTACAGGGGCTCAGACTGATGATCGTCTCTAAATTACAGGACCCGCAGCAAATTCTGGACAAA
CTCGACGACTTCCCGGTGCTCTACAAGAGCGTGCTGCTGTGGTTGCTCGACCTCATGGCGGAGGTGGTGCAGAACCAGGAGGCGAACAAGATGACCGCTC
GAAACATGGGTACGCAATAACGTCTTGTGGATAGAGGATGACACTGAGCTCTGGGCTGACTAAAGCACTGTTTGTTTCGTAGCGATCGTGATGTCGCCCA
ACCTATTCAGCATCTCGACCGACAACCCAATGTACGCGCTGACCATGTCCCAGAAGGTGGCCGACTACACGTTCGCGCTGCTCAGTGCGCGGCTCAAGCT
CGCATACCCGCAGGTTCAGTAAGACGGGTGAGGATGGTGAGAAATGGGAAATGCGAACAATGGTTATGCTACATGGTTTGTTGTATTGTCAAATAACTTA
TGGACAGGTAAAGAAGAGATGCAAGGCACACAGGACGAAGCCCCACGTGGAGGGAGGTCGTCGTAGAAATACAAAAGCTGGGATGATGAAGACCTAGAGA
GAGGAGAGAGCCGGCCCATGAGGAGGAGAGACTCGTTTTTTTTCAGACCAGACAGCCAAAGCTCGGGGAGATCTGTAGGAACACGTCGTCCTCGAGACCC
TCTGCTTCGAGGTGCTGCTGACGCTGGTGCTGGTGCTGCTGAGGCTGAGGCTGCTGGTGAGTCTGCTGAAGCTCACTGTCGTCGTTCAACAGGCGCGCTC
GTCGTGAAGCAGCCGCCATGGTGGGCGACCGCAACATCGGGAAGAAGTCGTCGTCGTGGATCGAGGAGATCCCGTCGAGCGCATAGCCGCACGTCGGGTG
GTCGTCGTCACCAAAGTCCTCCATCGTGAGGCTGTACTCACCGCCCTTGAAGTCGCTGAAGAACGGGTCGTAGGCATCGAATGGGATCCCCGAGCTCGTG
TGCGTCGAGTGCGCGGCGAAGCGCACCGAGACGCTGGGCATCGTCGCCGCGTCGCTCACCGATGGAGAGTCCATGCACTCGTCATCCTCACCGGCGTGCA
TCATGTTGAAGAAGAAGTGCG