Description :
From Genome Similarity Track
Location :
scaffold_369:9561- 12625
Transcript NameFunction/comments
g7731.t1 DnaJ subfamily C member 2 protein
g7732.t1 conserved hypothetical protein

Sequence
3064 bases(100 bases per row)
GTACTAATGTCTTCGCTGACGCTGTCGCTGCCGACGCCCCCCGCGGCCTTCAAGGAGCCCAAGGTCGTGGTCGGCCTTGGTGGCTACTTCGCCCAGAAGC
GCGTGGAGCCCGTGGGCCGCGCCTTCAACAAACGCGCTCGCAACATGGCGCGCGGCCGCTCCGCCAGTTGTGACGAGCAGGACGACGCCTCCAAGGCCCG
CGACGCTCTGCGCAAGAAGGAGGAGTCCATCCTCCGCAAGTACAGACGCAGCATCCGCGGCAAGAACTTCCTGGACCTCACCATGTACCAGCAGTTGGGC
CTGGCGGACATCGGCTTTGACGTGACGGACGACCAGGTGAAGAAGGCGTACCACCGCGTCCTCATTGAGCACCACCCCGACAAAACCGGTAAGACCGAGA
ACGACCCCAACTACTTGGCCGTACAGAAGGCCTTCACTACGCTCATGGACGCGCAGAAGAAGCGCGCATACGACTCTCAGTGCGACTTTGACGAGTGGAT
CCCTACGGGCAACGAGAAGATCCTGGAGAACGACGCCAGCGGAGAGGGCAAGAGCTTCTACGAGCTCTACGGCCCCGTGTTCACGGCCAACGCCCGTTTC
AGTGAGAACAAGCCCGTCCCGACTCTGGGAGACGACAGCAAGCCCATCGACGAGGTGTACGCGTTCTACGACTTCTGGAACAAGTTCGACTCGTGGCGCG
ACTTCACGCACGACTCGGAGCACGACGTGGACTCGGCCGAGCACCGCGACCACAAGCGCTGGATGGCCAAGAAGAACGAGGCTGCGGCCAAGAAGAAGAA
GAAAAAAGAGTACGCCCGTCTCGCCAGTCTGGTGGACCGTGCGCTGGCCAACGACCCGCGTATCCGTCGTGTGAAGCAGGACGAGAAGGACCGCAAGGCT
CGTGCCAAGCGCGAGAAGGAGGAGGAGGCTCAGCGCCTCATTGACGAGGAGAACCGCAAGCAGGAGGAGGCTGAACGTGCCGCTCAGGAGGCCGAGGAGA
AGGAGAAGGCGTCCCGCAAGGACGCTAAGATGGCCAAGGACAAGCAGAAAAAGCTCTTCCGCAAGGTCAAGAAGGCCTTCCGTGAGCTCATGACTGCTGC
CAGCGAGCAGGAGCTGGAGGGCGCCATCGACGTCATCAAGACGGAGGACCTCTGCGACTCGCTCGACATGGAGGCCCTGCAGGCGCTCGTGGCTGCGTGC
GGCGGATCCGCCGACAAGCTCAACGCTTCGGGCCTGGCCGCTGTCAACGACGCCCTGACCAAGCTGTAAGCTCGCTGCAGCTAGCTCACTGCGGCGGCGA
TAGACCCCGTAACCCACAGCTTCATTAACATACAGAAGTACACCCGCATTTGCAATGATTGAGATTCCATTGGACAATTATTGCCATAATTGGATTGCTT
GAGAATGAATCTCAACTATTGTTTTGTAAAACCCTGATTACGTAATAATTATATTCCTACCGAATCACATGATCCTGCGTTATGTCATACCTCTGCAACG
TTTCGCGGCCAGTGAAAGGCATTCGAGCATCTCCGCAGCACCATGGCAAGTGTCTTCCCTCCTGTCTGCGCCTCTCTCTCTCTCCAATGCGCTAACCCCT
TTGCTCTCGTGCTTCTAATAGGGTCGTAAGAAACAGTTCATCAACAAGAAGACGGCGCAGCACTTCCACGTGGTGCACCGCAGTCAGCGGGACCCTAAGG
CCAACGACCCCGAGGCCTCCAAGTACGTCCTGCTGTCTTCCAGCCAACACGTAGAACTTCGTTCCGACTCCGAGTCCGACAATGACGACGACGACTCAGA
GCTGGACAGTGACGACGAGATGCCGGATCTCGTTGACACCCCAGCACCCACGAGCTCCAGTGCCAAGCCGAAGAAGACGACCAGCAAGGGTAAAAGCGCC
TTCCCTGTACGTAAAGTTCGCTTCGGTGGCGTGGAAGCTGAGGACCTCATCGACGAGAACGGCCTGCCTAGAGATGGCTACGACTACTCGCAGCACATGA
AGGAGATGGGACAGGGCAAATTCTACTCTGCCACGAGCCGCTTTGACGCTGGAGAGGAGGCCCGTGCCCTCTCTAGAAAGGTGGATCTGCCTGACGATGC
ACTGCCTAGCACAGAAGAGCAGGACCGACTGCTTGACGCTATCACACTCACGACAGACGTCATGGACAGTGACTTGAGGGAGGCCCTTGTGAACGACGAG
GCGTTCGAGGAACTGGACGACAACTTCGTGGTTCAGGCAGCTGAAGACAACGAGGAGGGCGGCGCAGACGACTTTGACTACGACGCGCACATTGCCAAGC
TGATGGAGGCAGCAAGTGGCGTCACTCCACTGCACCGCGGCAACATCACGGACAGTGAGGACGAGGAGTTCAGCGACGAGGAGGAGGAGTTTACTGATGA
CGAACACGACGTCGAGACGCCGGAGGATCGGGACGAGGCGCAACGTGCACTTGATGATCTCTTCGAGAAGACGTTGGCGGAGGAATACGACGACGAACAG
CTGGGCGAACTGGAAGAGGACGACCCGGAGACCCGCGGCAAGGAGACGCTGGACGGCGAGCTGCTCGCTGCCGTCGTGGAGGACTACGCGTTCGTACAGC
AGGAACTGGCGGACGCAGAGGGTAAACTGGGCAATCCGCTGCGTTCGGGCAACCACCTCAAGCAGGTGCTGGAGCAGTGCGAGGCGGAGCGTTTCGCCTA
CGAGTACGACGAAAATGCCGAGACGGAGGACGAGGAGGAGCCCGAGGAGCCCGCGGCGCGTGCCGAGCGCGAGGAGAAGGAGCTCCAGCAGCTGTTCGAG
CGCAACCAGTACTTGCAGAGGGAGGAGCGAGAGAAATGGGACTGCGAGACCATCGTGAGCACGTACTCGACGCTGGACAACCACCCGACGGTGCTGCGAG
AGGAGGCGCCGACGCGGCGTAAGAAGAAGAAACAGCCCGTGATCGCCAGCATCGCCGAGGGCGAGGACATCCGCAAGCAGAAGGTGACGCTGTCGCGTAA
GACGGGCATGCCGCTGGGCGTGTTCGAGACGGAAGGGCCCGTCAAGAGCAAGGAGAAGAAGCAG