Description :
From Genome Similarity Track
Location :
Scaffold_35:95607- 107851
Transcript NameFunction/comments
Physo_134968PREDICTED: similar to Dci protein
Physo_134969GA19815-PA
Physo_157113hypothetical protein
Physo_134972short chain dehydrogenase/reductase family

Sequence
12244 bases(100 bases per row)
CGGGTGAAGACCAAGCTGCTGATGCGCCAAGACACGGCGGATCGACTGTTGGCTACCCGTGAAAAGGACCTGGAGGCGTTCACGGACTTTGCGCAGACAG
ACAAGGTGCAGAAATCGCTCGGCGCGTACCTTGCTTCTCTTAAGAAGAAGTAGAGGGCCAAAGAGTGAGATGTTGGGCTGCGGTGGTGAGACCAGGGACA
GCACTCTCTTGACTAAAGCAACTACTATTTCCTGCAAGCCTGAACATACAACCTGTTTGAGTTTCATTTTGTTGTGGCTGCATTCAGGTATCGGATACAG
TCAGTATGTCTTCAGCTGCATGCTTCAGCTTCGTGATTCCTCCCGTAGCGACGTCTCTGCAGACATGTGAGAGCACAGCCCGAGATGTCAGAGGAATTGT
CGGCCCGACCAGCAGTATCCGTCGGATGCCTCCGCGAGGCAAGTGCCCAGGTGTCAACTGCTGCAAGCACAAATTACGAGAATTTCAGAGTACGAACGTA
CATCGCGGCCGAGTACCTTAAGTAAATAATTAATCACGCGCAGATGGAAGAGAAAGCGCTCCGACATGTGCAAACCCCGATAAAACACCAGCAGCAGCAC
AGCTTCACTTGAGTCCATTTCGACGGTGGTTGATCCCCAACGAAGAGAAATCCGTGATTGGATTAGTACAACAAATCAGGGTATTGATTGACTCCAGAGT
CGGCAGAAACGATAAAACACCGTTGACACCTTCAGCAGACCCCGCAGTTGCCACGCCCAACTGAGAGAAGCTGTACCACACACAAATCAAGTGCGGCATT
ATCTTTAACCTCGTCCTAGTTTGATAAGTTCACAACAAAGTGTGATGTATTGGCCATAATGCCCTTAACTGCAGTAATAACTACATGTAGTAATTAACGA
TTATAATAATCGTTGATAACCACTCCCCGAGCATGGATAACACCCGCTTCGGTTCATCATGATGCTCCGGGAGCGCTAGATTACATGAAGCTGTTGTACC
AACCCGAAGCAGTGCGGCGACAATCTTCAGCTGCCAGTCGACGCCGTCACTCTCGACAAGCCAATTCGCGGCGAGTGCGATGGGTGGGCGATACCCAATA
CGCTTCGGAAAATGCCGCCAACCCTGAACGATCCAGGGTAGCAGGAAATCAATTCCTTGGTGTCCAAATGAGATGCCACCGCCTCAACAAAAAGGAGATA
CCCGTGGAGCTGCAAATGCTGTGCATCTAGCGGATATCGAGCGCTACAACATCATGAAATACCGCCTTGGGCCAAGGGTTTGCGTGAAGGCCTTTTAGGG
ATCTAACTGCATACCAAACCAGCTCATTGGGTTAGCCACTTGCACGCAACTAGTAAGTAGTATCTACAAATCGTTTTTCACGAGGCCACAAGCCGAGGCG
ATGACGTTGTGCTTGTTGCACAGTCTCCGGCACAGATAGTGTATTACGTCTGAATCACAGAAGGTGATCAGTGGATCTCTTAGTTGTACTTCCCTCCTCG
AACCATCCTGTTCTCCCAGAACTTTTCGTAGCTCTTGAAGAATCTGGGGAAATTCTCCTTCACCCACTCCGGACTTTGTTCGTGAAAATCCAAACGTTGT
ATTGGGACAAACGTCCGAACTTGTTGTCGAATCTCTTGATCAGTGGAGGCAGCTTCTTCGATAGGGAGGACACGCTTTCCAGCACGGACGGGACCTTCTC
CAAGCCAAGAGCTCTCTCCTCGTCCTCTTCGCCGGTTTCTCTCTTTCGCAGCGAGCGGCCAGTGGGGCTCAAGTTATCCTTGACGAATGATACCTACTGA
AGTACTTCTGAACGCGCTTCCCCCTCCAGTACTATGCACTAACACAACTCGAAGGACAAGTCGGCAGTGATATCCATCGGATTGTTCAGAAAGCGGAAGC
TTTCGATCGAGCAAGTACAGTGCACTACATGCACTTGCAACTTCTGATGCGAAAATATACTGCAAGTACTTGCTTGACAAAGTCAGCGTCATCCCTTAAA
CCGCCTATTGAAGTTAATGCGCACCCAAGGCGTTCATGACCCTAGTGGTGGTCGAACATCTCCTGAAACACACTCACGTAAACGCTGATGCCGTGCAGGA
AAGTATCCTTCGCCAGACCCTCATTGTGCTCGTGCAGCAGAATCTCGGTTCGCTTCATGGGCGAGAATCCAATTACTGGGACGCCCACCTTGCGCAGAAA
GCGACTGTCCGTAGCCGCTGGAAAAATCTCCGTCTCCAGCTTTTCGCCAATGCCGGCGCATGCTTTCTGGAAAAGTTGCCACCACACGTTGTCGGCGTCC
AGAGAGGTGACGTAGTGCTCGTGCATTGGGCTCGTCCACGGCGCAAACTCCCACGAAACGCCCTCGGCAGCGCACCATTTGTCCAGCTTCGCCTTCATCG
CCTTCAGATCCATTCCAGGCGAAACCCGAATGTCAAAACCGGCGATGGCTTCCGTTGGAATCACATTGAGTGCATGAGTCTTGCCCCCGTCTTGCGAGAC
CCCGCTCTGCAGCGCCGTGATATTGACAGTCGTCACGTCGCCCAGCTTTTTCTTCTTCATGTCGCCGTGCTTGCAGCCGCAATCAGCACCAAGCTGCTTC
TCCTGCTCGTCACGGAACGCGAGTGCCTTGTTGCAGATGTCGATGATCTTTGAGGTGGCCGTGTTCTTGATGAACCTGCTGCCATGACCCGTCGGACCTT
CAGCTTTGACGTACACCCACCACGGAGACCGCTCACCGTAGAATACAGTGAACACGTCGCCAGGGTTGGCCAGTCCCTCGTCAAACGCGAAAGCAACAGG
CATAATGGCCTTGAACTGCTCGCTCTCCAGAAAGTTCCCCATTCCCTCAGCGCCGCCAATCTCTTCATCCGGAACGAAGAGCAGGTAAATGTTGCGCTTG
GGCTTGAATCCCGACGACTTGAGCGTGTGCACTGCTTCCACGTACTGAATGCAGACACTCTTCATGTCCTGCGTGCCACGACCGTAAATGCGACCGTCAT
CCAGAACTTTCGCCTAACCAAGCAACACATCCACCAGTGTTACATTACAACCTGCACTCTTCTTACAAAAAACAAAAGTTCTCACTTCGAATGGATCAAA
CTGCCAGTGCTCGGGCATCGCCGGCACCACATCATAGTGCGAGTTCAGGATAATCCCCGGAAGTGTCGGGTCTTCACCCTTCCAGGTCGCCTGAAGGAAG
GAAAGAAGAAGAAGAACAACATAAGCTCCAAACCTCAGCTCCCGCACCTGCAGCTTTTTACGTACCAGAACTACCGGTTTGTTCTCCACCGGCGAGAAAA
CTTGCACGGGGAGACCCACTGCCACATCGATATAGTATTATGATAAATATACGAACACTACATGTAGAAACATCTATCCATTGAGCAACGTACGCTCTCC
CAGATACCTACGCAGCCATTCCGCACACTGCAAGCGACGCACACACGTTGCAACAACCAGCCGTTAATGAACCTTCTCTCCACCCCCCGCAATGCAGCCC
CCTCACCTCGTTGTAGCTGCCGTTGGGCCCCTCGGAGCTCACGGTGCGCAGTCGCAGGAGCTCCAGGAACCTCTCGACCGGGTCCTTCCACGCCATGGTC
GTCAAACGATTGAATGAACTTCAAGAGCGGGTGGGAAACCTCTCTACAAGAACAGAGAAAATGAGCAATTTTCACGACATCTTCCTGTACAAGAACACTT
GACCGATGGAGGATACCCGCCGTGCCATCCGCCAGGGCCGGCTCCTGGCGGGCGAGGGGCTCTACGCGCACGCGCTGGACACTTGGAAGGCGGCGCTGAG
CGGCGCATACTCGCAGCAAGACTACGCCGGACTGTTCGTGCTGTCGTGCAACGTGGGCGAGGCCTGCGTGGAGCTCGCGGCGCAGTCGAAGAACGGCGTC
AATGCAGCGAAGCAGCTGCAGGAGGGTCAGGAGAGTCTGGACTACGCGCTGCAAGTGGTGGAGCAATGCTCGCTGCGGAATGTGCTGGGAGGGTACAGAG
CGTTGTATCGAGGCGTGCGGCGAGCTGAGGCACTGACGAGGAAGGCGGCGGAGCTGATGGACAAGTTGCGCCAGGCGGAGGTGGAGGAGACGAAGAAGAA
GAAGAAGAAGGAGGTGGTGGTGGAGTGCACGACTTGTGGAGAAGCTGGTGGGGTGGTGGTGCTGGACGAGAATGACGGATGCTACTACTGCAAAATGTGC
TACGACGAGTACTATACTGCTGAAGAAGTTGATGCAGTGAAAAAGGAACGCATGGAGGTCGGTGACACAGATGAGGAGGAGTCCGTTGCTGTTAGAGACG
TCGCTGAGGTGGAATCTGGCGTGGAAGATGACCTTGGCGGCGAAGACATTGAGGTTGAGATCGATGCCGCGGCTAAAGGCGGTGTGGAGATTGAGGTGGC
TACAGTACCAGAGCCGTCTGCAGTTTTATCGCCTGCGACGAACGGGGCACAGGACGAGAAAAGGCAGGATCGAGTCCGATATGAGCGCGTGGAGCTAGGG
TCGCTGGCTGACTTCCTGGCAGGTAAGCTTCGCGTGGAGAATAACGCCGAGCAGATCGAGACGCAGCGCTCGGACCACACAGCCGACGTAGCGGAGCTGT
TGACGCCCATGCCTGCTGATACTAACCCGCCTGATGAAGGAGTGCCTGACCACGACGCGCTCGCCAAAGATGAAGATCACACCGCTGATACCAGCCTGCC
CGAATCGGATTCAGCGTGCGAAGAAGATCCGAGGTCGGACGAGGATGCAGCAGCTGTCGCTGTCGCTGCAGTCCCCACCAAACTCGAGTACTCCATCGCG
GAGCTGCTAGAGCTCCGAAAGCAGTCCCCCGCCGCAGTTCCTGTTGTTCTCCTGTCCTCCCCCGTCTTCGACGACGGCACCGCGCCACCCCCTGCCCGAA
ACAAGTCCACCAACTCAAACTCGCGGAAGAAGTCCAGCGCCAAGAAGACGGCGAGGTAAGCAAGCAACTGGAGCGGACAACAGCCGCACTCAACTCACTA
ATGGGTCCGGTTCGTGCCCGTGCCCTCCACTTGGCAGATCAGCAGTCGCGTCTAGGCAGAGCAAGGCAGACGCCGCTGACCAAGTGGACGACGACACGGA
TTCGATCTCGCCGCTGCCAACGCTGGACCTGTGCAACGTGATGCGCGCGGCGCTCCAGGAGCAGCGGGACGGCGCCGATCCCCATTGCAGCAGCTCTGGG
ATACTGGAGACAGCCCTCTATACCTCGGCCCATGTCCGCCTTGAAGCAGAGCGGCCTGATAACGGACTATGATCGAGCAGTCCCATGTTGCAGCCAATCA
ATCGATTCCGTGACCAGTCCTTTAATGCGGCCGTTACAGAAAACCGTCGGCTGCCACCTCGAATATTCGTATATCGCAGGTTATTGCTCTCGACCGTCGC
ATAAGATACAAATGTCAAGTATAACTGAACCAACGCAAGTGTACCTTCATTCCCAAATTATCAAACACGGAAGGGTCTCAGCGCGCTCATTCATCGCGTA
TCGCAGGTAAAAGTGCGACGCGAGTGTTGGTCCCTCCTCGCACCACTCACCCCACACACAAAGAACGAAGCGCGCACGGACGAAAGGCAAAGGCAAGAGC
GAACTCGGCACCACGTAACCTTCTTCTCCAGACGCTGCCATGGGGGACCACCACCAAGAGGCGTCGAGCGCCGAGCTCACGCGCAGCTTCCTGAGCTTCC
GCATGCTCAAGGAGGCGCTGGAGTCCACGAACATCAAGGACGACGAGGAGGTGAGTGTGTGCGCGCCTTTACCCCGCATTGTCAGTGGTGTTAAATTTAA
CACCACTTAAACGCGGCAGCCATTTCCTCTTACCGGCAACACTTAAAGGTTAGGTGGTGCTAACCAAGGTACTTGCATGCTGTGTTGCCATGTACTGTAT
CTCAGGCCGTCATGGTCACGCGCATGTGCGTGGACCCGCGCCACGTCGAGGAGTTCGAGCGCCTGCTGCGCATGATTCTTAAGACCACACACACCGTGGG
CCACGTGTCCACGTGCGTGGTGCGGCCTCCGCCCGGAGAGTTCACCTACACGTCGATTGTACGTTTCTCTCTATCCATGCAACTGCAACTTTTGTATAAG
ATAGTGCTAACCAGATACATGGTGCTAACTTATTCTTGCAGGTAAAATACTCGGGGCTGCAGGCAATGCGGCAGATTTACCCGTCCACAGTGGAGAATGG
CGTGGACTTTTACAAACTATTGGCAGCCCGTGATTCGCTGCTGCTGGAGCCGCCGACGTACCAGATTGAAGCAGGTTTCGGCACGTGGATCGAGTCGGAC
GGCAACACGAAGCCCATGAGAGGCGACGACCCCGAAGAAGACGCTAATCTGGTGTATCAGAGCGTCCCTGGACCTTGTTGCAATGATTCGTGCGAGAACC
CGCACGGCCTGAACGTCCGTGCGTCGTTCGTGGCCCCCACCAAGAATTTCCAGCTCTTCCGACCACGCTACCAGCGTAACAACAAGAAAGGAGGCCAGAA
GAACTTGCGGTGCTTCCCGTGCTGTCGCAACGGGCGCCACGTGAGCTCCGGCTTCTGCGGAGACTCGATCCGTGTGCACGTGGCTGTGAGTCGAGTGACA
GAGTCGGGAGGTGTGAAGATTTGCCCCATTCAGACAACGCGTCCGGCTGTGCTGGCCTTCGCGCGGTTCCTGAACTTGGAGGGCACATTCGACCAGACAG
TGTCAGGGCCGGAGGTGTTTCCTGGGCAGACGATCGAGAAGACGGACGTGCTGGCCTGGGTGCGTGATAAGGAGCACCCGATGAACCCGCTGTTCCCGGG
AATTCTACGCGGTGCAGCCATGGAGACCTCGTCGCAGTCGGCGATTTTTGAATTCAATGCGGAGTGCAAGGCGTGGCATTACGGATGGACGGCCCCGCGT
GGGCAGGGACTCTCCGGTAGCGATGCTCAGCACGTGCTGGAAGTGCTGTTCATGAAGCCCATGGGGTCGTACATGTACTGCCTCGAGCGTCTACGCTCGG
ACGGATTTTCTATCTACTCCAGCCGAAGAGCCAGCCATGCCGTGACTATTAAACCCGAGGTGGAAGCTTTCGAGAACCAGGAGACCGTGGACGACAGAAA
TCTCAAGCGAAAGCGCACAGTGCGTGCAGAGGTAGCCTCGCCTTCAGTAGGTGCATTAATGCCGCCGACACCAGCCTCGCCGGCGTCGACGGTTGTGTCA
AGCTGTGCTGCCGATTCGCCGATTGTATCCCCCTCCAAGCAAGACATGACATATGCCCGCCGCCCGAGCGCTGCACGTGTGCCGGCGCCTCCAACGTCCA
CTGGTTTTGTGGATCTTTCATCACCGATGACAGACGTGCCTCCGTTCAAGATGGAGAACATTTTTGGCTCGGTATCTTCTCCAATGGCGGTTTGTCCTCC
GACATCCTCTGTTCTTGTGGACAGTGCGTCATCGGGTTTCGACTACCGTGGACTGGATAATCTGATGTGCGGTGGAGGTATGATGCAGAACCAGCAGCAA
CAGCAACAGCAGCAGACCCGTCAACAGCAGCAGATGCTGATCAACCAGCAGAACCAACAGCTCCAGCAACACCAGCGCGAGCAGCAGGAACTGTTGCAGC
ACCAGCAACGCCTTATTCAGCAGCTCGCAGAGCAGATGATGATCAGCCAGCAACAGCAGCAGCAACAGCAGCAGCAGCAACTCCACGTCGACCACCTGCA
GGTTCCCGGGGGTCTCCAGAGCCACTCGCTGTTCCAGGAAGAACAACCCGCACGCCGGGTGGTTTCAACGGAAGAGCTGCCGTGGTCCGAGCTGTACAAC
CTGTTTGACCCCGCTCCGCTGTCCCCAGCTAGCACCGACGACGACCCTGACCACGATGAGGAGAGCTTGCCCAGTCCTGGAAACAGCCCAGCGCCGTCTT
CAGTTGCGAGCTCGGGAATGGCTTCTCCCTCTGTGGCGCCAGGACAACAGGCCATTTTGAATTTCTTATAACATAGTTCAGGGGTCTCATCGAGCCTGCC
GCTGCGGTGATCAGATCAAGACCGAGAGTCTCCAAGACGACAAGGGCGAAGCAGCATACGCAGCTGAGCTGCAAGCTGCAGTATATCCGATGCGCTTATA
TTTGGGGGTATTTTTCTTTTAGCTGTTTTAGTGGAGCGTTGTGCAACATGAGATGTGACGAGTGCCACGAGGAATATGCACACAGCGCATACGTGTGGGA
ACCTGCTTAGTACAGTAGGTAAGAGCAGCAAGAAGTATCAGCATCAGCATAAATGCAATTTACGGCTCTCAAATTTTCGATGAAGAAATATAGAAAACTG
CGGCTTAATCTCAAGTAATCTCGGCGGTGATGCGAGTAATTTACTGCCAACATGGACGAGGAAGGCACGAGAGCAGGTGGAGACGGAACGCGCGGAGCTT
GGATCCCGGTGACGCGATGAGGCGCTACAACGGCCAGGGCTGCAATCTGCGCGATGCGCTCCAGGGCGAAGGCATGATCCTCCATCAGGGTATCCAAGCA
GACCAAGGAACTGGAGGCCACTCCACTCGAGGCATCGCAATGGGTCCGTTCAATCACCGAGGAGGACGTGAGCCCCATTGGCCGCTCTCTGCGAAAGATA
GAACCCGACGAAGAGGACAAGGAGAGAGCTCCTGGCTTGGAGAAGGTCGGAGAAGTTGCCTCCACTGATCAAGAGATTCGACAACAAGTTCGGACGATTG
TTCCAATACAACGTTTGGATTTTCAAGGATAGAAGTCCGGAGTGGGTGAAAGAGAATTTCCCCAGATTCTTTAAGAGCTACGAAGAGTTCTGGGAGAATA
GGATGGTTCCAGGAGGGAAGTACCACTAAGATCATCTTTAGACTAAAGCCTTTAGTGATTCAAAAGAAATAGAAGTGCGAGAAACTGATAGCACGCAGAA
CCTCGGTCATCCTCTACTTTTTATACTTCCTAAAACTCCTCTTCGCTGTAGTTTTCATCGTCAACGTTGTTTAATCATCGCTTATCCCACTGCATTTTTA
CAAGTAGTATACTACTTGTGCTAGATATGGATCGCATTGATGTGTTGGTTCAAAACCTACCGTTTAAGACCCTGATGTTAATCCCGAGATAAAAGCTATA
CGAAAATGTCCTTTGAAGAATGGAGGACACTCTCGCAGAGAGAGTCGAATATGCTGTACGTAGTCAGTAGCTTCCCCGTCGGCTTCGAAATCTATTATCT
GTAGCTCTACTGTTCCTATACTCTCGCTCTTCATTCTGTAAATGGCTTACTCGCCATATGTCTTTAAATTTCTCACCGTGTCAACATCACACCCAAAAAT
TCAGCGTTTCCTCGTGCGCAACACGACTTTATCAGTGATAATTTACACTTCTGTTAATGTACATGCATCTACGTGCCTTCAATTACCGGACCCGCTGTAC
GTACATTAGTAGAGCGTAGTTATACTTTCCTCTTCGAACCATTCTATTCTCCCTGTGGTTTTTGTAGATCTTCGCGAATCTGCCTGTAAACGGGAAAGAG
CACGAAAAAGGCAGACGTCCAGGTCGAAGTAGAACAGTGATAGATTTAAACGCACAGTCATTTTGTCTTTTGATATGAAACTCACTTTTTACCTCATTCA
TAGCCTCGCAGTTTTGAGGCAAACTTCCATTGGAACCTGCACTCAATGTTCTGGGCCAGGAAGTGGTAGCGGTATCTTTGGTGTTCCAGATGAATCTGTA
AACTGATCCTTAAAATGTTCTGGATGGCCAGGCTCCCCTCGATGCTCAAGTGAAAAGGGTATGGGAAAGAAAGGCCTCACACATTACCTCTACTTGAGCG
AGCCTGATGGAACAACTATTTTTGTGAATTGACGGTATATACATGTACATGTATGGTGCCAACACTGCATGCACAGCGTTTGTCGCTTTTGCACACGAGA
GTTGTAAGCTAGCATGCAATAGAAAAAAAAGTTACGGATGTAGTATTTTGGTTCATTAAGTTTAGCTTGCTCACTGATTCAAAGTTACTTCAGCTGTGGC
AAATTGTCCTCATACTTTCAGATTCGTCTATTTACGTCGATGTTTACTCCCAATTGATCCTTTTCTGAGATTACTCGCACTAACGGCTCGTTTGGCCACT
TTTTACCAAGCTTCAAACTACAGCTTCGAGGGGCCGACACCCGTCTCCGCAGCGCTCACCATTCCTCCATCGGCCGTAATGACCTGGCCTGAAATCCACC
CTGACGCCTTGGACGCCAAGAAGATGGCGAGTCCCGCCATGTCCGAGTCCTGACCCATGCGCCCGACAGGAATCGTGTCGCTGATCTGCTCGAAGGGCTT
TCCGGTCACGTAGGCGACTCCCTCCGTCAGTCTCGACGGGACGTAGCCCGGCGTGATGGAGTTCACCAGGATGTGACCTCCGTTCGGGCGACGAACGAGC
TTGGCCGCCAGAATGCGGGTCAGGTGGTGCAGCGCCGCCTTGGACGCGTCGTACACCATCCCGTTGAGCTTCTGCGGCATCAAGCCGCCAATGGACCCGA
CGTTGATGACGCGAGCCAGGTCCGAGGACGCGGCAGCCACGTCCAGCAGAGGCAGCAGGAAGCGCGTGAGCAGGTAGCCGACGTCACGTTCAAGGCGAAA
GTCTCGCTCCACGCTGCAGCACCATCAACCGTACAAGCTCCCACGAGACGATAGTTAACACTACAATAGCGTACCAGAGGCCGGGGTGCAGTCCACGGGG
GTGTCCGTTCCACCGCCCGAGTTGTTGACGAGCACGTCGAGACGCGACTCCCGCTTGATGATCTCGTCCGCGAAGGCCTTGCACTGCTCCTCGCTGGTCA
GATCCACTTGCAGCTGCAACAATGCACTGAGTTAATCCGACGCAGCTAGCACCGATATGAACAAGATACCTTCTTACCGGGATGCAGACTCCGGGTCCCT
TGGCGTTGAGCTCGTTGGCGGCTTCCTGGCAGACCTCGAGTCTGCGCGAGGCGATGTACACTCTGGCCCCGTTCTGCACAAATCCGTCGGCGATCATCTT
GCCGATGCCGATGCCGCCGCCCGTGACGATCACCACCTTGTCCTTGACATTGAAGAGCTCGGCGCCACTCAGCGAGCTCATGATTTCTCAACTTCCACTG
CAGAGTATTGGAGGGGGGGGGGGAAATGAATTGTGGAGACCTGATGAGCTCGAGGACTCCAAGGCTTGGGGTCCTCGAGCCAAAGACTCCTTTGGACCTT
GAAGGAGGTCCAAAGGGATACACGTCAGCAGTGCTAGAAGGTGCTGACTCAGCATCTTCTGACTTAATAGTCCCGTCCGGGCGAACGAGAGGCTACCTCC
ACTAACTAGTTGAACATGGCTACATTTGTGATACCGTACAGATCTCCCCGGCAAATCTGGAATACAGTAGCGATGTCGAATGTACTCGCAGAGCTGTAGT
ACAGTTAATAACTGTACAGTTATGCAGACGAGATTCGCGCTTGCTGGATGATGGGTACTGAGTTTAGTGAAAAATGGAGGGACCAGGCCTTGCAAGTGCA
AGTTGCTAAATAGTGAAAGGCTCATAATGAACTTTAGATAAGTTATTGCTGTAGCACGATGCAATCATGACGGCATACGGCATGGGCGACAGTACCTTGC
CCTGAACGATGAGGCAGTACGGACATTAGAACTCCCTAAACGACCGTCCCAGGCAGCGGTCTACGTGACGCGATGCTCCGCGACCAAGACAAACTCTTAC
AAGTACAAACACAAGAATATTGGCGATATTCGGCGATACAGTATTATATCACCGACCCCCCTCAACGACCGCGCTCTGCTTGAAAACTGAGCCGACGGTA
CAAGACGAGGCGCTACTTTCCCATTAATTGAGTAATTCAAACATTGACATTTCTGTCAAACCCTTTGCAAGTTTTGCAACCTTGCAGTTTCTATTGGCGA
CCTTTCCAGATTTGCCGGGGCAGACTGTACAAACGACTGTCCTGGTTGCATTGCACTTCCGCTCTCATGTTGTACAAGCTGAATCTCTTCTTCGACGGGA
GACAGACATACGCAAGCTGCCAGAGCCGTCAAAATCGGAAAGAGATGCTCACTCACCTTTTATGGGAGGGCAAGCCTGCTGGAAGCATCTTAACCTGGAC
GGCAGTGTGATGGCACTGCAACTCCTTCGGTTTATTGCGAAATTCGCAGTAAACCGCAGTGCGAATCGCGCCCCACCTTTCAGCGGCGTGCTTCATGAAC
AGGCTGAAGACTACTGGACTGCGGCAATTACACGCACTGCAGTA