Description :
From Genome Similarity Track
Location :
Scaffold_24:95558- 97666
Transcript NameFunction/comments
Phyke_g1574hypothetical protein

Sequence
2108 bases(100 bases per row)
GCAATGCGTAAAATGATCAAAGTGGAGATACAACGAAGACAACAAAAGCTTCTAGCTCTGCTTGCcagcaagcaacagcaggcaGCATGTAGGATAACAT
GCTGCATACGGCGTTACACAGGACAGCGCTCCCTGGTTCGAGTGGAAGCTGCCCTTCGTATTCAAATATTCTGGAGAAAATTGTGTGCTCAGTGGGCGGC
ACTTCGTCGGGAGGTGCTACGGCAATGGCGCCTGAAAGCTGCTGTGTGTATTCAAAAACATGCGCGACGAATAGCAGCAAAACGAAAGCACTGTTTGCTG
ATAAAAATTGATAACGTAGAAAAGCGTCAACGACAAAAAGCTCTGGAGCTtgccacaacagcaaaaaacaCGATGTTGCTAGGCGCTGCAATTACCATCC
AGCGGGTGGTCCGACGTTGGCGTCAGAGACGTATCTTAATGCTACGCTGTCGCCGTGCAGCTTTTGAGAATGACAAGAAAAAGATCCTCGAAGTCCAAGC
TCACTACCGGGGTCGACAAGCACGCAAATGGGTGGATAAACATAAGCGTGATGTGTCTAAAGCagttcttgttcttcagtGCTCCTGGAGATGCTATCGC
GCAAAATGTGAATTTTGGAGACGCAAGGAAAATGCGCGAACCCGGAGAGAGCAACTGCTAAAAGAAATTGAAGAGCGCCGTCGATCCAAACGATCCAGTA
TTCTTTCCCCAGTACAAATGCAGGGAAAGTGGGGTCAATTTTCACTCCTGAAAGGTACTAATGCTGGCCGCTTGAGCGAAGCCTCGACTTTGCGGGAGGT
TCAAGCAGCTAGAAAATTACAGGCGAGATGGAGAGGCAAGCAAATCCGTCAACGACTTCGGCATGAAAAAGCTAGGGATACAGAATTATTGCGGCGCAAA
ATCAATCGAAAGCGTAGGCTTGCAGCGGTCTGTATTCAGAAATGTGTACGGGGAATTAGAGGTCGCGCTCAGGTGTGGCATATAATGGAAGAAACGAGTG
CAATACGAATTCAGCGAGTGTGGAGAGGGTTTAACACACGATCTCGACTCCTAAAAATGAGAGCGGCAATCGATATGGTTAAACGGATTCAAGTGCGGTG
GAGAGCTAGGCAACACGCAGAAAACCATCGCTTGCGTGCGTGGAATGCGTCAACCATTCAGCGAGCAACGCGCAAGTTTATTGGGAGAAGAATGTTTTCT
TTAGCAGTTCGACGCCGCCAATTTCTAGCAGAGGAGAGTGCTGTGGGTAAGGTTTTTGTTGAAAGGACCCGCAGCCGTATCAAGGACGAACTTTTGCTGC
AAAGTTTTACTTTTAAAGTGCCGCTACACGCTGATGACAAGAGGCAGCGGCAGAGACAGGATGTGTTTGCGAAGGAACACCGAGGGCAAGAAAATGCTAC
TCGAGTGGACAGGTCACTTTATGATGTAGACTTGGTGAAAACCCAGTGGAAACGCAAAGGTTACGATGGCGTTTGGCAGGAAGTGTACCGAAATGCAGCC
GTCAACTCACTAGAGATGGATAATTCTCATTTCGCACGGTTCCTCAAGGCTCTACCGCACGCTTTTATCCACAAAACGCACTTCCCAATGCAGGCTGCTG
ACGTTATTTTCGCGAAGGTGAAAGAGCCAAAGGCAAAGACCATATCATTCTCGAGATTCAACAAGGCCATCCTGATGCTACTGAAAGAGAagtttgctgg
tggagataGGCACAAGGAGGGCTTAAAGGGTTCGCAACCCGTCGACTCCGACAGCGATCACGAACGATTTCTCCGCTTCATGAGCCGTTTTGTTCTTCCC
TCGGCCATTCAAAGCGGAAAATACCGGAAAATGTTGGACATCCATTGCACGCACAGGCTGCTTTGGTCTGTGGCAGTGCTCCGACGACTTGCTATCAGAA
TTGCAACCAAGATAAGGCATGATAAGTTTGTGATTGCTTCCAGGGAACAGCAGAGACTAAAACACCGGAGCGAATGCGCCTCCACGATTCAATTGGCATA
TCGCTGCTACAAATTTCgcttgcagctgaagaaaaTACTTGCAAGTATGTTTATCGAGTTCATAGATCACGCTGGCCGCGCGGTCAGATTCCAACATATT
GCCAGCGG