Description :
From Genome Similarity Track
Location :
Scaffold_14:95555- 97025
Transcript NameFunction/comments
Sapdi_VS20SDRG_05305sarcosine dehydrogenase

Sequence
1470 bases(100 bases per row)
TTCGGGATGTGCAGCTCGTACCCGAGCTCGCCCACGAACGTGAGCCGCAGCATGCGGAAGGTGTACCCCGCCATCGTCACTAGGCGGTGCGTCGAGAACG
GAAACGCGTCGTTGGAGAGGTCGGCGCCCGTGAGCTTCTCGAGGAGCGGGCGACTCAGCGGCCCTTGAACGCTAAGGACACCAAAGTCATCGGTAAAGTC
GGCCAGTGACGTCTTGGGGAAGCGCCGCAACAGCGATGCAATCCACGCAAAGTCGTGCGTGGCCGAGGCACCGCCGGCCGTGATGTAGAACGTCGTGTCG
TCCACTTGGCTGACTGTGAGGTCGCACTCGGTGCCGCCCGCGGCGTTGCACATGAGCGTATACACGGTCGCGCCCGGGCCCTTCATTTTGTTGGTGCAAA
TGTACTCGATGGCCGCCGGCGCGTCGTCGCCCGACAGGACAAACTTGCCAAAATAGCTCTGGTCGAAGAGCACGACAGTCTCGCGGCAAGCGCGGGCCTC
GGCGCCGACAATCTCGTGGCTCCCGGGCCACCCAAAGGTGTTGTCGGCCTCGATCGCGCGCAAGTACGGGTCGTCCGCGTGCGGCGTATGGTTGTAGTTG
CCGTAGTAGGTGTAGGGTTTGACCGCCACGTCGCCTTGGCTGCGGACGTCGGCAAAGTACCCTGGGCGTTCGTAGCCGTGGCGCGTCTGGAAGACGCAGT
TGGCGGCCTTGAGCTTGGCGTGGAAGGGCGTGAGGCGGACGTTGCGGCCGCCGAGGGGCTCGTCGTGCGGGAACACGATCGAGTAGTTCTTGGCGTACGC
CTCGTGCGACCGCTCCCGGTTCCATCGCTGGTGGCCGAGCATGCTCAGGTGGTAGCGCTGGATGTCGTACGAAAACATGTCGATCGTCGGGCGACCGGCC
GTGACCCAGTGCGCGAGCTGCTGCCCTGCGCCGCCCGCGAGCATGATGCCCGCCGAGTTGAAGCCGCAGCCAAGGAAGAAGCCTCGGACGCCCGGCATCT
CGCCGAGGAGCGCCTTGTGGTCGGGCGTGAACGACTCGGGCCCGCACACTGTCGAGCGCACGCCCGTGGCTTCGATGATCGGGACGCGGTTGACCGCGCC
GTTGATGTGCGTCGAGAAGACGTCCCAGTCCAAGTCAAAGAGCGAGAACGCAAAGTCGTTCTGGACGTTCTCCCAGAAGATCGGGTTGGGCTCGTAGCCG
CCGACTTGAAGGACGTCGCCCTAGCTACTGTGAGCGACTGCATGAAGAGGTTCCGAGTACCTGCAGCTTGAGGTACACCGAGGCGTCGTGGTCCCGAACG
TTGGGCATGTTTTGAATGCCCTCGATGCGCTCGGTGACGACGTACGCGTGGTGCATGGCGCAGAGCGGAATGTCTTTTCCCACCATCTTGGCGATGTAGT
TGGACCAGACGCCGGCGGCGTTGACGACACGCTTGGTGCGGATGACGTGGCCGCCACCGAGTTGGACGCC