Description :
From Genome Similarity Track
Location :
Scaffold_11:95538- 97221
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_04153similar to titin isoform N2-B

Sequence
1683 bases(100 bases per row)
ATGGATGTCAACCCTTGCAGCGCCTGGGCCACCACGCTGCTGGACGCAGTGATTGGAATATTGACGGTCGTTTGGCCACAAAAGACCAAGTTGAAGTAGC
CACCAAGGTCGGCGTTGCCAGCGTACGCAAACACAGACTGGATCTCCCGGACGGGTCGCACGACGGTCGTTGTTTTTGTCACGAACGGGGCAAACGACCC
GGGAGTCACCTCGGTTACGGTCAATCCCACATCAGCACCTTGTAGCCCTGCGGCCGATGCCACGAGCAGTGGGAGGTTGCCAGAGGTGCCGTTGAATGTC
ACAGTCCACGTCGTTCCAAACACACCGCTTGGAGCTCGTGTCACAATCGCACCTTGCACCGTCGGGAGAGCGTTGAGCGCGTCGGCGACCATATCGCCTG
TACTGTTCCACGACAAAGCCGCCGTACCGTAGCTCTTGAACGACAGCGAGAACGTTCCGGCAAGAGCACTGGTGCCAGAGAGTACGATGCGCTGGACCTC
GGGTGCACCCGGTGTCGTGTCGACGTCCACGATGTACGACGAGATGGGGATGCCGCCGGTATCGAGCGGCGGTGTCCACGACACGAGCAGTGATGTGTTG
GACGTAGGCTCGACCACGACGTTGATTGGCGCATCGGGCGTCGATGCCACGGTTAGCACTGGAGGCGTCGCATACATGGGAGCCCCGAATGCATTTTGGA
ACCCGTTCCAGGCCGAGACGCGCACAAAATACGACGCGCTTCGGCGAACGTTTCCAATCGAGTACGACACGACCGACTGCCCTTGGGCAATGGGTACAAT
CGCGTAGCCGTAGAGAGCGCTGCTCATCGTTGGGAGGGCACCAGGCTTGGTGAGCACTTGAAACGAAATCGTCGCCGCCGGATCCGTGCTCGAGAGTTCA
TTGGTACTTGGCGACAACACCGGTTGACTGCCCAACTGCGTCAAAAACACGACAATCCACTGGTAGCCGAGGCCTCCCGCATACCGCGAGACCCACAAGT
CGCCCGTGTTGCCAAGCCCAAGCAGTGCGTTTTGCACGGCTGCGGCACTGGCGTCAACAGGCAGTGCCACGGTCGTTTGGCCGTTAAATGTCAGCGTAAA
CGAGCCTTGCAACGCGCCAGCATTGGTCGAGAGCACAAGCGTCTGCTGGTCATATCCGTTGTAGGCCGAGATAGACGTTGTGATTGTGAGCTGCGCGTTC
GTGCCCGTGAGGAGCGACGTGGCAACAGCGGTTTTCGACGCGGCAAAGTTGACGTGCGTGTCGGACGCGTCGATCGAGCCCAAAAGCAGCGGAATGTCGC
CGTTGCGCTGGGCGTTTTCCCGGTTGGTGAGAAAAGTCACGAGCCACTGGAAGCCGTTGCCGACGGTACTTCGTGACACGGCGACGACACCGATGGGGTC
GAGCGCCTGCAACGCTGCTTGCAGATCGTTGGCGGACACGCTGTACGCTAGCCACGGCGTGACGTGGTTGGCAAACGAGAGCCGAAATTGGCCGTTCAAA
TTGAACGCAGAGGCCGACACGACGATGCTTTGGACGGCGCGCGTCATGTAGAGCAAGCTGGACGTCGCAAGACCAGGCGTGGCGTCGACCGCCTCTTGGC
TCATGCAATCCCACTCGACTTTGTACCTCGTCACGGGCGCCCCGCCGTTGTCATGCAGCGTGCTAAAGTTGACAGTGATCGAG