Description :
From Genome Similarity Track
Location :
scaffold_8:95534- 119189
Transcript NameFunction/comments
g531.t1hypothetical protein
g532.t1 60S ribosomal protein L6, putative
g533.t1 GTPase
g534.t1 phospholipid-transporting ATPase, putative
g535.t1 conserved hypothetical protein
g536.t1 myosin-like protein
g537.t1hypothetical protein

Sequence
23655 bases(100 bases per row)
CCTTGTGCTTCTTCGACGTGAGTGCCTTGGATCTGATTCTCAGCGTGCGCTACAAGGGCTTTTCCAATAGAGTGCTCGCTACCCCTCTCTGCGGCACCTA
CGTATTGCCAGACCTTTATCTCATTCATGTCATTTGGTGGTGTGAAGACCCCAGCAACGCCAAGCTGTGCAGTGGTAAGCGTACCCGTTTTGTCAAACAC
GACTGCATCCACCTCCTCGAGTGCCTCCAAAGCACGACCGCCCTTGAATAGTATACCCACCTGGGAACCTTTTGTTGTTGAGACCATCACAGCAGTCGGC
ACGGCCAAGCTAATTGCACAGGGGCAACTAATCACCAGCACCGTAATCGCAAAGCGCAACGCGAACGGGAAAGGAGCCCAGCCTTGTGTATCCACTTTGC
CATGCTTAGCGAGAGAATACCAGAGCACGAACATTACGCCAGCCAGGATGATAATGAACGTTGTAAAGTAGGCAGCCACACCATCTGCAATGCTTTGACG
CACACCGCGAGAAGCCTGGGCCTCTCCTACCAGTCGCACCATGCGTGCCAGCATCGATTCATGAATGGTGTGGGTTACCCGCATGGATAGAACACCTTGC
GCGTTAATAGACCCACCGATCACAATCGCTCCAGGCTCTTTGGGCACTTTGCGGGCTTCACCCGTAACCATCGACTCGTCCACAGAACTTGCACCTCCGA
CAACAACACCGTCCGTAGGAATTCGAGTACCAGGAAGAACTTTCAGCAGATCACCTCGCTCCACGAGCACCACGTCGATATACAGCTCTTTTTGGTCCTC
TTCCATCAAAATGGCTGTCTTGGCTTGCATGCGCAATAATGCATCGACACTGTTCGAGGCACGCGCCTTCACCAGCGTTTCGATGTAGCGGCCGACGAGA
ATGAGAGTAACGAGCAGAACAGTGACCTGGAAAAACGTTTCCGTTTTAGCTGGCGCCTCCACTTGTTCCAGCGGAAGACCCGTCGAAGGATCCACTTGAG
TCGGCACTGCTTCTGGTACTTGAGACTTCACGAACGCCCCACCAACAACCGTGAACACGGAAAACGCATAGGAAGTGCAGGCACTGAGCGAGATAAGCAC
GTCCATAGTAACGCGTCCACCGTAACGCAGCGCCAGGAAGGCACTCTCATGAATGGGGCGCGCCACGATGAATAAGACAGGCGTCGCGCATACCAGCTCG
ACAGCATCTCGGATACTCAACCGGTTCGCGGTGCCCCAAAGACCCGCATCTGCTGGATTGGATTCGGAAAATGGATAGAGCGCTGGCAGCACGAACTCTA
CGAAGATCACCGGGAGAGACAGCAGGCAACTCCAAAGTAAAAGGCGCGTAAAGCGTCGAACTTCTTCCTCGCCGGCACGAACCGACGGTGCTCGCGGACT
TGATGCTTGAACAGTGAAGCCAAGCTCGCGGGAGAGTTGCCGAACGATTCTACGGGCTCCTACGACGTCTGGGTTGTACTCCACTAGTAGTGACTTGCCT
GAGGAAGCCGAAGAAACGATCGGCTCATCGATATCCTCAGCCGAGACGACACCAGCAATCTCGAGTGACAACTTTTTGGCTTGATATGAACTCTCCGACT
GGCCGAGATGCAGGACGACACTTACAAGTTCATCGCTCGATAGTACGCTGGGCTCGAACCCCAAAGTGGCCACAGTCTCCTCGATGTGCTTCGCCGACAC
CAGTTCCGGGTCAAACTGGAAGATTCCGCGACTTGTGAGCAGACTCACGTTCACGTCCGTGACACCACGTTGTGATATCATGAACTTTTCGATACGCGTA
CAGCAGCCACTGCATGTCATGCCACCAATGTTCAAACGGAGGATCTCCAGCGAATCCGCTGTGTTTTTCTTTCCCCCCGAGCTTTCCAAATGCGCCCGCT
GCTTCTCAAGCGAGGCTCCACGGTCACTGCGGAACTGCACCAAGCGAGTTAAGAAACTGGGCGATCTCTCCGGAAGCAGCAAGTCTTTGGATTTCGACGA
CGAACAGCAGCCCGATCCAGGCGATTTCCCTTTGTCCTTTGTAGACGATGAGCAGCAACCCGACTTCTTGGACTCCTTCGTAGAAGCGCAGCAGTCGTCA
ACTTTGACCTCGACCTTTGACTTCTTCGAGCAGCAGCCCGACGTCTTTGGCTCCGTTTTGGAGGCACAACAATCGTCAGCTTTGCTGTCGATCGTTTGCT
CCTTTGAGCAACAGCCCGACGTCTTCTCCTTTTCCTTTGTTGTACCACAGCTCCCACCGTTACGTACAGCATCACCAGTCTCCGATGAGCAACCACTCAG
AGGTTGTGACTTCTTGGAGCAGCAGCCGGCATCGCTAGAAGACTCTGCTACGTTTGACGAGCAGCAACTTGAAGATTCCTTAGGTTTTTCCTTATTTGAA
CAGCAGTTGTCCGCCTCAATAACACCTTTCACGGCTTCATTGGACGTTGAAGAGTTGCTGCAGCCTCCCTCCTTCTTCTTCTCTTTCTTGGAGCAGCAGC
CGCCTACTTCCTCTTCAACCTTCGACAAGCAGCAGCCTCCTGCTTCACCGTCCGCCTTGGACAACTTGACGTCTTCATCGCTACTCGAGCACGACGCAAC
TGTCTCTGCGCCGTCGCTCTTGCCGCCACAGCAGCCGCCAGCCGAAAACCCTTGCGTCTCTTCGATCACAGGGTCCGACTGCGTTAGGTTTGCGGTGGCA
CAACGTCCCTTACGCTTGCCCATGCCTTGTCGACTTCTTCTCGGTGGGTACCTAGGAGACACTTGCTCAGATCGCGGTGTGTTGAACAGTGAGAGTCGGC
AGCGTGGAGGCCAGTGCCACACGGAGAGGATGCGATCTGTCCTGCTTGAAGAAAGTCTCGTAAGGAAATGTTGCTTTTCTGTTGCGCAGTTTATTCAGCA
ACTTCAGCGCAACATAAAATGCTTATCCGGATCCGGATGACGCATGGATTACGTAAATACCGAATTACAATTTTACCGGTACAATACTTGGTACTCTACC
TAACCGCTAACCGGTCTTTTCGAACCGCCGAACCGCTTCTTTTGGTACGCTGTACCTCAAAATGAATATCGCGTACGCCACACCATCTTCTGTGGTTGGC
TGTGGATAGCTCTCGTGTGGTGTTCAGGTCTTGTGCTGGCTCAGTTCTTTTCAGACAGGTAAGGGTCAACCGTCATGTTGTGCTCCTTCGTAGCTCGTTG
TACAGCTGGCTAACCTTCTCCATGTATAGGTATATTCATCACCATGCCCGCCAAAACTGCGAACGTCGTCCTCGCCCGTGGCATCAACGCCATCTCCGCC
AACAGCCTCTCGAAGAAGAACGGCCGCGGCAAGGTGGTCAAGAAGGGCGGCGAGAAGAAGGTCGCTGCCAAGAAGGTGTCCACCAAGAAGTGGTACCCGG
CTGACTACATCCCGAAGCCGCTGCCTTCGGCCAAGACCAAGCGTAACAGCGTGAAGACTGCCAAGCTGCGCAAGTCCATCACCCCTGGCACGGTTCTCAT
CCTGCTGTCAGGCCGCTTCCGTGGCAAGCGCGTTGTGTTCCTGAAGCAGCTGGCTTCGGGCCTGCTGCTTGTCACCGGTAAGTTGATACTGCAACTACAA
TCAGCAGGCATTCCGATGATGCAAAACTTGACACTTCGAGAGGCGCTCTGCCACTCCCTCACGTCTGCTCACGCCTCCACAACTCGTGCCGCATATCTGC
TTCTCTCCAATGACTCCGTTTACGGTTTTCTAATGGAGGCCGTCGGTTTGTGGCATGCGATTGCTGCTGGAGGTTTGCTGTGGGCGGGAGGAAGTTTATT
TTCGCCGAAGATCCATCAGATTATGAGACCTGAGGAATGCCGGCTAGTAGTCTTCAAAACTCAGAACTTGTTCATAATAGCAATGATGGCTAACAGTTTT
CTTTGATATGACAATATAGGCCCCTACAAGGTCAACGGTGTGCCTCTTCGTCGCGTGAACCAGTCGTACGTGATTGCCACGTCGACCAAGGTCAACATTG
AGGGCCTGGCCCTTCCTGCCATCGACGACGCCTACTTCGCCAAGGAGAAGGCCGCCAAGAAGAGCAAGGAGGAGCAGTTCTTCGCCCAGTCGAGCGCCGT
ACGTAATTTCCCTTTTCTATTCGCTTTGAAAGCATCCCGTTCCAGTTGGTCGGTTCTTCAGGACCAATTCACACAGTTCGTTCACATCCAGCAACGAAGT
GGTGGCGGTGATGGGGGCTAAGATTGACGAACCCACTGGGATCTCTCTTGGTGTTCTGTTGCGAGCCCTTCGTTGCGTGGCGAACCAGACAGAGAAGCTG
ACGTCTTTGGACTCAGCCTTTGTCATACCACATGAGCGCTTGGGATCGCTTGCTTCGGCACATAAGCTCCCTATAAGACACTGACCGTTTGCTGCTTAAT
ATTTTCAGGCCCCCGTCATCTCGGAGCAGCGCAAGAAGGACCAGAAGGCCGTTGACTCGGCTCTGATCAAGAAGCTCGACGCTGAGCCGTTCCTCAAGGC
CTACCTGAACGCCAAGTTTACTCTGACCAAGAACGACCGTGCCCACGCCCTGAAGTTCTAAGTGGCTACTGCTATGTAGCTGCATGACGTCCGTCGGACT
GCGATGAAAGGAACAATATACCTGATGAAATTATCACCAATCTCGAGTTCACTTTGGTTTAACCTAGAATTTCATCAAGCAAGTCTTGAAGAAGCGTGCT
GTCACTTTTGGCATCGTCTTCGCTGTTTGTATCTGGTGTACACTTTCTTGCTGAATAGAAACTGTCGTCACCTTCGCCTACTAGCGTGTTGTAGCTCGAG
CTCTTCTTCACCAAGCTTCCTGCGAATGAACCTGTCCTGCTTTGCATCGAAGCAGTATTAATATCATCCAACACCCCAGGACGAGCACTGACAAGTGAAG
AGCCCCATTCCTGGTGCCGTGTGTGCGTTTGTAGTCTCTCTTTGGCAGTCCACAAATGGTTTTCGTGTCGCGACGTCAATGCACCCCCAGCCCAAAGACC
AGACGTCTCAACAGCACTCGCTGGAACTTCGTCTGACTTTTTCGTACACAGATTCGAACGCCCTGTGTAGCTCGAGTATCCCCCCACCGACTTATATTCA
CTTCGAAGTGGCAGCACGGGCACTTCTTCCTCGGGCATCACCAACGGGGGGATTGTTAGTGTCGGTCTTGTCACGGTCTGCTCGAAAAAGCGGTGTTGCA
GGGCCTGTGCGGCTGTAATACGTCGACTTGGATCGAATTGTAGCAAGTCTTGTACCAGTTGAACAGCAGAGGAGGGTGTTCCTTGAGGAAGAAATCGCTT
CCACGACACAGGAGCACACTTGGGGAGCCGGACTTGCATTTGAGAGGCCATTGCTGCTCCTTCAGGCCACGTCTCCTTGGTAGGTGTACCAAGAACCTTG
CAGATGCGGTAGAACTGATCGGCCTCCGACGTACCAGGAAACAGTGGCGTACAGATCAGCATTTCAACCAAAATGCACCCGCAGGCCCACAAGTCGATGG
GGCTGTTGTACGTCGTCGAGCGGAGTAACAGCTCTGGCGCTCGGTACCATCGAGTTGATACGTAGTCCGTGAACGGCGGTCTTGATCGGATCTCGCGAGC
TTGGCCTAGGTCTGCGATCTTGAGTGTATCATCATGACACAACAGGTTCTCAGGTTTAATGTCACGATGAAAGTAGCCGTGCTTGTGCATGTACGCGAGG
CCACTGAAGAGTTGGAACATTATTGAACGTACTTGAGCAGTCGAGAACCATGGATGAGGCAGTGATGAAGGCTCTGAGCTGGAATTCGCTTCGGCTCCTG
CACCACTAGAGTTGCTTCCTCCATGATTCTTGAGGTTCCGCATAACCCGAAAAAGCGACGTCTGCAGGTACTCGAAGACAAAGTAGAGCTCCCCTTTGTC
TCGAATGACCTCTTTTAACAGCACAATGTTTTCATGGCGTAGCACACGGAGTGACTTGAGTTCACGCAACTGAAGACACTCCTCCCACGTGGGAAACAAC
GCCTTGATCTTTTTCACAGCAACGATCTCTTGTGTCTTGAGACTGCGAGCACGTGATACTTCACCGAAAGCCCCATCGCCAACTCGATCCAGTATCTCAT
AGCGGTTCATCTTTTGAAGACACCAGGATTGCCCATAAAGCCGCCTTTTATAACTGAACAGAAGACCGCACCTTATTAATACACACAGAACAAATTGACG
ATGACATCTCGTGTTGCTATAAAACCGAAGGGAATCTCAGTCTATGAGGACTTGGTTAGCTTGCTGTAGCTCTCAATCATCCAGCGGAGCGTACGTGCTA
CCGTATCAATGTCAACCTTGTGAAGTGCACTGTTCAATTCAATGGAATAAATTGAGTTCGCAGTACGCAGAATTTGAAGAGTGTTGGAGCATTTACCTGA
CTGGAAGCACGGCAAGATCAGTGGACTTGCGCAGCCTGTGGAAGTTGTCTTCAGCGCCTGCAGAACCACCACATACAGTTTAAGTACTCTTTACTTAGTA
GAGTAACATGACTGCAGAAGTACTACCTGGCTCATCCATCTTGTTAGCAATGATCAGGGAAGGACGTGACGAGATTCCAGGGGCGTATAGCTCCAACTCT
CTCTGAAGGTGTGTAAAGTCCTCCATAGGGTCACGTCCCTCTGAACCCGCCGTATCAAGCACATACATCAAAATCTACAGCACTTCAGTTAGCATGCAAT
CCCGATAATTGAACGCATTCTTCACATACCTTTGTACGCTCGATGTGACGCAAGAAGTCGTGACCAAGACCAACATTGCGATGCGCACCGTCAATAAGCC
CGGGAATATCAGCCACACTCAGCCGGTAGGTGTCCGGGAACTCCACAATGCCAACGTACGGGTGAAGCGTCGTGAACGGGTAAGGTGCGATCTCAGGCGT
GGCACGGCTAAGCACACTCAGCAAAGTAGACTTGCCAGCATTGGGGTAACCCACCAGACCCACATCGGCAATCGTCTTAAGTTCCAGCTCGTAGTACTGC
GACGAGCCAGGCGAGCCCGTAGTCTTGTTCTCGGGCATGAATTTGCGTAGACTTCCAAACTTCGTCGTCTTGCCCGCCAGAATCCGGTTGCCCAGTCCAG
GTTTGCCACCCTTGGCAGCTAGGAACGAAGCACCAGGCTTGTCTAAATCAGCTACAACCTCCATCCTGTCGACAATCTCCCACTCGCCGTTATCCAGTTC
TCGCTCATAGCGCTCCACGCGCTTGACTAGCGTGCCGCACGGCACCTTCACGTGGCAATGCTTGCCTCTCCTACCGGCGGCATCGTTAGCTATATGTGTA
ACCCAATAAAGCCATCGGTCAGTATCAATAAAGCAAGGTAAAACATGAGTAAAAGCATCCGTACCCATGCCGTTGGTGCCTGCTCCGCCCTTGAAGTGGT
GCGTGGCATTTCCCAGGTTCTGCATCTTGTCACTGGCTTCGATCACTACGTCACCTCCACCTCCACCGTGTCCACCATTGGGCCGTTTGCGCATGGCCGA
CTCGGAGAAAAAGCTGGCGCATCCGTTGCCTCCGTGGCCGCCCGTGGCCTTAACGCGGATGCGGTCCACGAAGCGGCGCTTGGAGTGCTGTGCGCGTCGC
ACGCTCACCTTCCGCTTAACATGCTCCTCCACTTTGCGGCGGCCAGAAGAAGCCACGTCGCCCTCGTCGTTCAGTTCCCATGCCTCGTCCACGTCGTCGA
TGTCGTCCCAGTCCAGTTCCAGCTCGTCCAGCTCCAGTTCCTTGTCGTCCTCGTCGTCGCCATCTTTAGAGCTGAATGCACGCAGTGCAGAGCGGTTGAG
GATGGTGCGACGACGCACTGGCGCTGAGGTTAAGCCTCGCAACAGAGAGGACACGCGCAGCATCTTCGCGTCCGCAGCTTTTTAGTCGGTGGTGGAAACG
TGAGTGGCTATTGATAAATTTCCTGTGAAAATTGTGATTTGACCTTTGGCAAAGAGGAAATTGCCATAAAAATGGGTGATGACTTCAACCACAAGAAGCG
GATCGACTGTTTAAGCCAAAAACTGTTTAAGCCAAAAACTGGCAGGTAAGTTGCGAGCAAAACTTTCTGTACCTAAAGGAGAACTCGCTGCAGAGTAAGA
AGTTTGATGTATTCGTGAAAATTCAACTAGGGCCTAACCTTGCACTCATTCACTCATGTTACACTTGTGATGGAGCTGCGACTCATGAGCAATCGAGTCT
CTGTGGCCCCTGCATAACCGTCTTTGGAGAAGGCAAAGCCATGATATGCCTTTTGCATCGTTGTCCTGTGCTGCAGTTGTCGGGCATCAGTGGGGATGAC
CGAGCCACTTTTCTTGGCGACTCTTACAGCATGAGGAAGCCGAGCTGGTACCGCCACAGACGCGTTGCTGTTGTCATTCCATTGCAGAAGTTTGCGATCG
AGATTGAACTTAATGACCTCCTTGGCCAGTTGCCAATACTCAGGAAAAAAAGTGGATCTTACGCCATTAAGCAGATGCGCGTACGACAGTGCAGCTACTG
GAACGAACAACCAGATTAACCAAAAGGACGGAAGGCCGAACGCATGCTCTAGCATGAGTTCCCATGTGAGATCAGCAAGGAAATCGACGTGACTGCAAAC
CAATGCAACCACGAGCCACATGAGAAGGGAACCGAAGTACAGGAAGTAGTTGAAAAAATAAAAGCTGTTCTGGAACATAAACAGCTTGGCATTGGCAATC
GACACGACCAACGTGAACACGATGAAGCCCTCCAGCCACATTGTGGGGCTCCCTCCTGCAAATCCAGCAGCCTGCAAGCTGTACATCGTAAGAAATGTGA
TAATGATACTTTCGGCAATTGCACCGACGACCCACAGAGAGAAAATACGGGTGTTGATGTCTTCGTCGCGTGGTCCTGTGAAATACAGCTTCGGGAAGGA
CATGGCCACTTCATCATTTACGTCTTGATCCAAGATTGAAGCTGCAACAATTGGAATTGCCGTGAGTGCGATGTTGTACAGTTGCGTGCCGCTCTCAAGA
AAAAACTTCTGCCCCGAGAATCCACACAGAAGCGTGTACCAGTACTGAGCCGCGGTAAAGAGAATGTTCTTGTAGAAAATATACAACACCAACTGCGCCA
TACGTCGGTAGTTCCACCGCCCATGAACGAGTAACAGCCGCTGTAAGAAGCGAAACTGGGCAATAGCGTAGTCACTCGAATTCACAGCCTGCATACCTTC
TTGACCTGAAATGCCAACGCCAACGTGCGCTTCTTGGATCATGGATACATCGTTTGCGCCATCTCCGATAGCAAGGGTTCGGACACCAGGAACGTACTCC
TTGATCAATGCAACCATCTCGGCTTTTTGCGCAGGAGACACACGACACGCTATAACAGCTTTACAGTACTGAGAGAACTCCGCCAGGAGTGGGCGACACG
ATCCCCGCAAAGCGTACATCAGCGTTTCGCCGTCAATAACAAGAGCTAGATCTCGTAGTTCACCACGAGTAGCCGGTGGCGAAGCCAGGTAAACGGTGAC
ATCAGCACCTCGAGCGCCAATCTCATCTCTCAAGGTGCTTTCTAATATCTCGGAGGTCGGTGCATTTTTCCCATTAATGATGAAAAGTTTCATATCATTC
GTCACGAGCTGGCAAGCGAAGCCGATGTTAATAGCGGTTTCTTCCTTGTCGCCTGTGAGCACCCAGATTTTGATTCCGGCACATGCCAAGTTGGCGATCG
CGTCGGGGACACCAGACTGGAGTTTATCTTCGATTGCAGTGGCTCCAAGTAGCTCCAAGTTGCACTCAATCTCATTCATGCATTCATCAATCGCGTTTGG
CAGGTCCTTCTTGCGTTTGTCGATTTCGTTCAAGTTGTTCTGGGCGTCGTGGAAGCGTGTTGCCCATTCAGCGTAGTGCGAAGGCTCGATTTCACGGATC
GCAATCGTAAGTGTGCGAAGACCGTCTTCTGCATACTGATCGATGTGACGGCGGGTTATCTCCTGGAGCAGGGATGAAGTGGATTCATGTTCTTTGTCCT
GTACTAGGAGTCCGTAAATGATCACATCCGCTCCTTTTGAGTACAAAAAGATCCGGCCATTGGGATGACGGATGATCGTGCTCATGCGCTTTCGCGTACT
GTTGAATTCCAGCACATCCAGCATTTCATATTTTTGGACGGTACCTCGAACTTTAACGTGCGCGATGCCAGGTGATCGATTCACGAATTCGTATCCAAAA
TACCCAGCTCCTGCCACGAGAGCCTGCTCATCAGGTGATGAAGCTGAGAGAGTAACTTCTGTAGAATTCTCGTGACGTTCGGGAATAACGGTGTGGCACA
CTGCAAGATGCGTGAAGAACGCGTCAATTCGCCCTTGCTGCACGGATCCCGAGTTCCCTTTCATGTCATTAAATAATTCCGGACCGTCGAAATTGACATA
AGGAACCTTAGGGCCCTTAGACTGCGCAGTCATGTCTGGAAGAGGTTTACCAGCACGTCGTAAAGCTGCCAACCCGATTTCCGTGGTTCCATTGCCGTAC
GAAACTCCGCCAATTGAACATTTTCGGAACTCCATGACGTTGCACGTAAGCGTTCCGGTCTTGTCGGAAAAGATATAGGAAATCTGTCCGAGCTCTTCAT
TGAGTGACATGGAGCGCACCAGTGTCGGGGTGTCCGTGTCTGGGTGGTAAATGTTGGCATCCCACTGGATAAACTGAGCTTGGAGGTACTTCACCATACT
CATGGAGACAGCTAGTGAAATAGGCACAAACTGATACATGAGAAGCAGGTAGTAGAACAGCATAATGAGCCAGTCCACGAATGCGCTGTTTTCGGACGCA
TCCAACTCGAGATACCACACGGAACTGTGGTTCGACTTCCACGACACTGCACCGGTTGCACCGACAGCACTAAAAACAATCAAGATTACCAGCAACACGA
CTGTGTACTGGTTGATAGACCGGTCCATCGAGCTCATTTTCGATGGAGGTGCCGAGTTACTCATCATGATCTTCGTATCTTTGCCAGTGTTGAAGACTAC
GCCGTGCACCCATTCTGTATTGCGGATAATACAACCACGCAGGATGATGCTTTCGTATGGAATAGAAGCCTTTTCCTTCCCCTCGATCTCCAGCACACCC
TGGAAACTGTTGATCGCATTGTTCGGGTGCTCGCACCGAATGACACCTTTCATCCTGAGCAAGTTGTCGATGGAGCCCATCTCTGCTAGCGTGCATTCCA
TTGCAGAACGAACTTTCATGTTGGTCTCTCCATCCAACGACTTGGTTTCAACGTAGCAAATACCACACGGTGGCTGATTCGGTATTTCGCTTACCGCGAG
GACAAGCATATCTGTAGGTACCAGTCCGCGGTTTACAACTTTGACGACGTCTCCTACGACAACATCAGCCCAGGTAACTTGTTTGAAAGTATTCGTCTCG
CGATCTAAAACCAGTGTTGGGCTAGCATTGGCAATATTGTCAGCTTGGTGGCGTTTGTGGTCTTCGAGAATCGCAAACACACCGTCCACCGTGATAATGA
ACAGCAGAGGTGGCAACGTCGAAGGGTTTCCGTTGGTATTGCTGATTTGAGGGATGCACTGCAAAATACAAATGATGAGGAAGTAGAGATTGGAGAGTTT
GCGGAAGCTCTCGAAGAGGAACTTCGGCAGGAAACTTGCGACCGTATACTTCGATGTCACAATGAAGTTGTTGCAGTAACCCGTTTCGGTATTGCGGTGC
GCATCGTTTAAATGAACCACGCGGAAATCCCCGCCATGCCCCGCCGTTCCTTCACCCATGGGTCACTTTGTCACGAACTGCTGTAGCCAGACACAAGCAG
GAAGGTGAGAGGGAACGCCTAGTGGTAGCTTCACCGGGCAAAGTGCAGCAAGAAGACTCGAATGCGGCACACACTAACTGCTTGGAATAGTCCAGGGAAA
AGCATGCTGAGATGAAGAGGAGGGGGTTTCGCCTTCCTCGACCGCTGAGCTCCCCACAAAATCGGATGAAGAAGCTATTTTTGCCGCAGAGCTTTGCCAC
ACTCATCGATTGATCTCCGTAGATCACCACCCGCAATATAATAAAAAACTGTCGGCTTGGCAGTGTCTAAAGCGACAGGGGGTTCATGCTTTTCATTGTA
CTTCAACAAAACGGAGACAGAGTGATGGTCGCTCCTACCCTTGAAGTTCAAACCTCTCACTTTTGGATTTGCCGGATCAAACGCAACTCGATGAAGGCCC
AACGCGCACACCGACGCAAGTTGCGCTTCTCGTCCACCAAAGCCGTCGCCCCAAAGGTGACCGTCAAGGCGGAGCAAGCTCCCCAGCGGTCAATCAAGCG
GCGCAGACGCCAGCAGCGTGTTAACTCAGTACCAGACAGCAGTGCAAGCCCCGTGGACAGCCTACCAGCATCCATTTCGAGTGGCATCCAAGAACGATTT
GCTGCAGCGAAGAGCCTGGGGGAAATGTACGTTTCAATAAGAGCTTGTCATAGGTGAGTCCCATGGTCGGACGACTGATACCGAGCTTCTTCTTTTTTCA
GAACGCTCACAGTGTTGCAGCTCTTTAAGGAGCATGAGGGACTGCAGCGCTCTGTGTCTGGCCCCGTGTTCCCGATCCTTGTCCCGACGAGTGAAATCTA
CAAGATGAAGGGTAGGACGTGCATTTTTCGCGAGTGGATGGCTCCTGTCCTGATGCTCGCTTCATAGTGCCGAGGAAACGGCGGATCTACGACGTGTTGC
ACGTGCTGGAAGGTACATTGCTTGCACAAATTGGTGGAGGGAAGTTATGGTAACGTTTGCGACTACAGGCATCGGAGTGATCAAACGTGCCCGGTACAAT
GAGTCACGAAACGCCAAGGGAGGGTACTTCCGGTACTACGGCAAGGCTGCAGTGGTGCAGCATCTGGAAGACATGAAAACTAACTCGACACAAGTGGTGG
TGGACTTTCGGCACTCTCATCGCTCGATGAGAAGCGGCATTGTGGAAGAAGATAAAGCCCTCGTGAAAATCTGTGAGAATCAGGCAACAGTTGAGAGCTG
GCCGTGCTTGGTGACGATGACAGTCTGCTTCTTGGGCCTGATGTTTCAACAGGATCACGTTGGAGTGGAATTGTCTACTATTAGCGACCGTCTTATTGAA
GCAAAGAAAGCTATCGCAGTGGCGCCGAGTTCTACGACGGAGGTGGCGTACAGTGACGTACAGCGCCGTGTGTACGACGTGGTGTCTGTGCTGGGGAGCT
GCAACATGATAGATACGTCGCTCGTGCATTCCCCCAAATGTGTTGACAAATGTCTTCGAAAGCACGTCCGCTTCAACTACGACATTTTCACGGACCCTCG
GTTGCTGTTTGCTGTCCCTGCTCCCGCGGCGAACTGGAACGACTCTACGAACAGCGTGCCGTTGTTTGGCGACATGGTGATAAGCTTGCGCGGTCTTAAG
AGTCCCCAGTCAGGATCTTCGGAACACCAGTTGATTTCTCCACCGTTGGCGTACTGGCAGAATCTTCACGCTGCAACAACTTTGATGGCACCACCCATAT
TTTCACCCGCGGCTGCTTCCGTACCCAGTGCTAAAAATCGTGATACGACAAGCTGGGAGCTACTTATAAACGAAGAAACGCAGGGGACACCAGTAAAATG
CCAACCAAGCTCACTTATGACGCCAAATAACTTTGTGAGATGCCCGCCACAAGCACAAACATCACCTCGCGTCGACAAGTTTTTCTCACCATTCGGAATG
GCATTGACAGCGAAGAATGAGTGGTATGATGAGTCGCTGAAGCATCTTGGGCTGTATGAGGCTCTACCTGCCGAAAACAAAATCGACTGGGAGCTAATCA
AACTGTTCAAGGAAAATTATCGAGACATGTGGGGATACCAGTATCCAACCACGGCTGCACCAGCCCATCAATTATTGGTTGACAGAGCGGATGCAACGGT
GACAGATCTCGAATGCCACGAATTACTAGGCGACAACATGCCGGAGAATACGGCAAACTTCTTTTGCTGATCAAGAGTCTCGTATTAACAGGCTACACGA
TTTAGGGATTGCTTCAAAGTACGTAACTTCACATCCGCTTTCTACAACTTGTTTTATTATCGTGTTTTCCCAGTGATTCTTTAAATCCATAACCCACTGC
TGCTCAACGGAATGTCTGTCACGCCGGAGCAGCTTAGAAAACCACTTGACACGCTATCGCCGTCATCATCCTCCCAGTCGTCCTCTTCCCAGCCTTCATC
ATCATCATCCTTATCACTGCTGCTGTCATCTTCCTCCTCGGTTTCCAAGCCACTAGCTCTCCGCACTATTTTCACTGCCTCCTTTTCTGCGGCTTGTGAC
TCAAGAATCAACGACTCAGCACGGTTGCGTGCCAGAGCTGCAGCAAGCTGACCCGCGACAAACCCAGGCACAGGATTTGCCTCCAAGTTCAGCGTCTCCA
GGTGAATGTTGACGTCTAAAGCTTCCAGCAGTGCCTGAGCCCCGACCTTTGTGATTCGATTGTGAACAAGCTCCAGAGACTTGATCGTACAGTTGCAGCG
GATGGCCTGGGCAAGAGCCTCAGCCCCACGATCCGTTATCAAGTTGCCCCTCACGTGCAAATGCTTCAGCGAGTCGTGCCCGTACAGGGCTTGTGCCAGA
GCCTCAGCTCCTCGATCACCGATATTGTTGCCGTATAGATCCAGGTACTCCAGAGTTGTGTTGTTGCACAGCATCTTCGAGAGAGCAATCGCGCCGTCGT
CTCCTATGGCGTGGTCCCGAATTAAGAGCTTCCGGACTGTGTGGTTAGTCGTCAAAGAACGAGCCACGAGAGCACACCCTTCAGCTCCCAGCCGCTTGTT
GCGTTGCGCGAGGGTCGAGAAGTCTAGCTCACTCACGTCTCCGTCGTTCAGGTGGATGCGTTGCAACATTGCACCCAGCGTCGGACCTAATTCATCGAAA
CGTCATGAGTCAATTCAATTTGTCACGGTCAGGAAAGGAAGAACCTGGGACTGACCTTGAGCACGCGAACTGCCTTTTGGTAGTGACATGTTCGGGTGTT
TATTGTCACGGGATAGCGGCGACTTTCTGACGTCAATGGACTTTGTTCGAGACGATGACACAGAGGTTGAGGATCTCGACGAAGAAGTTCCTGTTGTGCT
CGTAGACGTCGGAGCTTGCTGCGACTCGAGCTTTGAAAATTCGTCAGTGGTAGCAGGTTCGTTGCACTCTGGCTCATCGACTGCAGCAGCAGCTTCTCCA
GCAGCCACTTGATTCACTTCTTGATGGTATTCCTCGCCCTTCGCTTTGCCGTCGCCATCCGTTTCCTGGTTACAACTCGCGCGTTGCACCGCCGATGACG
ACCCACAATCAAGTTCAACACCCCGCTTGTCGGAACCGCGAGCCACCTCTTGGACGTCGACCTCCATTTCCGGGTCAGGCTCTAGATTTTGAGTTGGTGG
TGCCACCTCGACGGAACTGATCCCAGTGGCGGGAGCAGCATTTTCAGGCACAGCAGCTTGACCAGTCTTAGCCTTCGCAACGGACTTGGATCGAAATATC
AAGCGCCTGCGTTCTCCCGGTCGGTCTCCGCCAAGCAATTGGCGCCAGTAGCGCTACGGGCGACAAGAACCGGTCAACGGCAAGAACAACAACATCAAAA
CTCGGATGGATGGAAGCATGAGTACAAACCTCGAGGTGGCGCTTAGCACGACGAAGATTGATGTCGGGCATCAGTAATGCCATCTACGCCGACTTATCGG
CAGTGCGCCGCGAGCTCTCGCTCCCCCTGACACCTCTTCTGCTTCGAAAAAACCGAGCCTTATTGCAAGGCAAAACTCTGATGGAGATGATGCCGGAAGC
CACACAATAGTTTTTCATGTCCCCCTGTAACTCACAGCGAAGGAAAGACATCCATCTGCTGATGGACAGGTGTGATACAGCTCCCGTGTTCTCTCCCGGA
TTCTCGACAAGGTTAGAATAACAGCGATGTCAAGGTCAAGACTGAAACCAACAACAAACATTTCAAGTCGAAAATGTAAACTACTCAACGTTTTCACATG
TTTGCAAGAGAAATTTGATCTTGTCTTTCGCTACAGATATACGCCTTGCGGCGTTTACTTAAAAACTGTTGTCCTCTGGCTGCGGTCTTGGCTGGGAACG
CAACGAGGGCCGGGACACCGCTGCACACACACCACTTCACCTTTTGCGGCTCTTGTTGATCTCCAGGATGATGGCCTGCAGCTCGATGCACTGCTCGCGC
ATCAGTTCCAGATCGTACTTCAGGTTGCGGTTCTCAATCTTGAGCATCGAGTTCTCATCCTCCAGAGAGATACCGCTCGAGCTCGAAGTGCTGCCGCTGC
CACTGCGCGTCTTCATGAAGCTCTTGGCGCGTTGCGAAAGCTCGTTCAGACGCTTCACGCTGCCACGGCGACCCGAGTGAGCCACCTTGAATGACTCCAT
CCGGTCCGCGATCGATCTTCCGCGTCCTGCACGAACCGAAGCGGGGTCATCACCGAAGCCCTCGTCAGCATCCGAGTCATCAAGGTCGTCCATCTCGTCC
ACCCACTGGCCGCCACCATTGTACTCCTCCTCTGAATTGTACTCTGGCTCAACCGGCACAGCCTTATACCTCCTCCAGCCACGCTGAATCTTGATAATTG
CACGACGCTGGAAGTGATACTCTTTGTAGTCCAGCGACATACGAGCGTACGACTGCAAGACAATGACAGCACCGATCTTGTTGCGCAGGCGACGGCGCTC
CAAGAAACCCAGCACGATACGCTGGATGGTGCGCGCCTCGTAGTACATGAAGTCGGACTTCATGGCTTCCAGCTCCTCCATGACGCCGTTCTTGAAGTAG
ATCAGCGTCTTACCCATCTGGTACTCCAGAGGCGACTTGCGGCCGATCGACGTCATGAAAACGCTGCACGTACGGCGGACATCCTTGCTGTGCATGGACG
GCGGGAACATGATGGCATAACGCGTGGCTAGCTCCTTCGGGGTCAGACGACTCGGGTAGCCAGAACGCGTGATACGAATGGCTTCGATCACACCGGCCGA
TCGCAACTGCTCCACGATCATGCGCTTGTTAAACTCTGTCGGACTCTTGTTCGAGTTCGGTTTGATGCAGCGCACATAGTGCGTGTTGGTAGTTCTGATG
TTGTCCATCAACTGCGCCAATGACGTCTTGAACTGAGAGCCGAGGCTCTTCGGAGCCTTCTTGCCACGGCCGCTGCCACCCTCTGCCGTAGCCTCGATGT
CAACGAAAAGTTCCGGAAGCAGTGACAGACTGCTGAGCTGAATCAAGTCCAGTAGATCCTTCTGCAGCGTGTCGCGATGTTTCTCCATGAAACCCACCGT
CTCGTACGTGACAGGACCAGCGTAGTGGTTCACGATGAACTGCGTACGCTTGACCTTGGGGAAATCGATGCTTTCGTTTACCACACCGTTCTTCTTCGTC
TGGTGGTTCGTGCGGATCTTGTTCACCAGAGCCTCCTCGGTGTCGCGCGGCTGACGCAGGTGGTCGTTCATCAAGGCGATGATACCCATCTTACCTTCAA
TCACCTCCACGATACCCTGGTTGTCCTGGTACTGAATGTGATCCCACTGCAGACCTTCGCGGATGTACTCGTCCTCGACAGTCTTGAACACATCGGTAGT
GAACTTCTGCTGCAGCTTCTCGTTCGCGTAGTTGATGCAGAACTGCTCAAAACCGTTGTGGACGAAGTCCTCAAAACCGAAGATATCCAGCACACCAATT
TGGCCCTTGATACGGCTCTCGTCCGTACTGATAGCCTCGTTGATTCTCACCACCATCCAGTCAAACATCTTGGAGTAAATAGTCTTTGCTAACGCATCAC
GGTTCTCTGCCGCTTCAATAGGAGCAAGTGGCACCGTCACGCTGTCGTTACGAGTGATCACCGTACGGTTGCACAGAGCTTCCTCGATTCTCGTCGTGGG
CAAACCGAACATCTTTGCGACCTGTGACAGAGCCGAGCCGCTCGAAATGCGGGATCCGTTTTCGCCACTCTTGTCAAACATGACCTCACCAAGCAAGAGA
ACACCAGCCAGAATCTTGAAGAGCGTCTTTTGCGCGCTGCTATCCAGACCAATGATGGACAGCGACTTCTGCGTGCTAGCAAACCACTTGGCGTCATCTA
GTCCAGGGATCTGCATCTCCGCAAGGGAACCAGCATACTGATACTGGCAGTCAGGGTCAAGACCAAACTCCTTCCGCTCACGACTGGGTAGACCAGCCAG
AAGCTGATAGAAAATGTGGTAGTTGCGTTCGCCTTCAGCGATCGACACCACACGCGATTTCTCTAGCAAGTATGTCTCGCACTTGGCACCAATCAGTTTT
CCGCGGCCGTCGAACTGCAGCTGCGTGAACTTACCGAAGCGCGAACTGTTGTCGTTACGTGTCGTCTTGGCATTACCGAAAGACTCGAGAAGCGGGTTCA
CATCAATGACCTTAGCGATCGTCTTGTCCTTGCGGCCACCAGCCACACTGGCCAAGTGATTCATCACAATTTTGGTCGTTTCCGTTTTACCAGCACCAGA
CTCGCCACTCACGAGAATACTTTGGTTCATCTCGTTAGTCTTCATGTGCTTGTAGGCAGCCGTTGATGTCGAGTAGACGTGAGGAGGCAACGAATCGCGC
GGCTTCTTCAGGTACTTCTCGTGTAGGTGGTCACCATACAGGTTCTCGATCCATTTGTACGGATTCACTGCAATCACGATGTCATTCGTGTACGTGTACG
GCTTTGAGGCAGTGAAACGCTGCTTTAAGTTGAACAGAATGGAAGGTTCGTTCAAGTATCGAAGCAGACGCATGTCCTCCACGCCCTCAGGGTTGTCGTG
AAGGATTGCAACAGGCAGTGATTCCACCTCGGTAGCCGTTGGTCCAGCAACAGCACGAATAACTTCCGGGTTCTTGAGATCGACAACACGCTGTTCCGAG
TCACCTGAATCCAGAAAAGCCGTAATCGTAACCTCTTTTCGGCGGTCATTGTAGTCCACAATCTCGGAGAGCAGCCACACTTCCTCCTTGTCAGGAATGT
AGCACTGCACTCCCGGCACAATCAGGTTCTGCTTGTTGCTTGCACCTGCAGCTTGCTGTCGGAGCTGCTCCTCCTTAATTTCCAGTTGCTCGTTCATGAA
AGCCTTGCGCTTCTTTTCCAAGCTGAAATTGCTGCGACGGCGCTTAGGAGGCACCCAGTACGTCTGACGCTTGCGGATGTAGTTACCGCGGCCAGTTGAA
CGCTCAATCATGTGGCGCGGCTTGAACGGCATCGGTGCAGCGGGTGCTGCATTGAACGCTGGCTTCGGAGCTGATCGACCACCGGCCGGGGAGTTTTTCG
ACGGGTTAAACGAACCGAAGGTCGGTTTTGGTGGAGCAGCGGAAGGCGTCGTCGCGATCGATGGAATCGAGTTCGTCGTAGCTAGGAAAGCAGCCAACTT
GCTCTGGGAGCGAGGCTTCGTCGATGATGCAGGGGATGCGGACGGCTGGTGCTTCATGAAGTTATTCAGCTTGTTACCCCCTCCTGTGTTAACCTTCGGC
TTTGACGGAGCGGGGGCAGGCACGTCTGGCTTGGGGCTGCTGTTGCCCTGAGCGAACACTGCCTTGCGCTGTGCGAACTGGTCGCTTGACGTACCACGAC
CTCGGACAGGTGCAGACTTGGGCGGGGAAGGCGGCTTAGAATCCGCAGTGGGAGAGGCCGACGACTTGAAAGCAGAGAGGTTCGAGCCACCAGACCCTTG
GTAAGGGCCTGAACCATGTGTCGTCTCGACAGCCGGCGGGTTGGATTTCATGAAAGCCGCGAACTTATTGCGAGCATCCCCGCCGGTCGGCATCGACTTA
GGAGGCTGTTTGGGCGACGGAGGTCTTCTGACTGTAGGCTGTGGCTTGGGCGCTGCTTTGGGTGCCGGTGGTTTCCTCACCGAGTTGGTCTTCTTTGGCG
GACCAGATGGGCGCTCAACATGCGTCAACGGAGATCCGTGGGAAGCCGGCACCTGGTTCAGGAAGGCGTTCAGCCGATTTGCATTGGCACCCCCACTGTT
GCTCCTCGTGTCCTTCTGTGAGGGCGGCTCCAACGGTGTCGAGGGCGGAGAGCCCGACGGCGACAACATTCCACCTTCCACCTGCGGAGACACTGGCGGG
GGAGTAGATGGCGGCGTTCCCTGCGGGGATTTGTCCACCACCTTCTTGTTCGACTTTTTCTTCCTCGATAAAAACCCACCCTTCATGAAACTTGTGAGCT
TGTTGTTGCTGTGCGCCTTCTTGACGGGGGACGGTCCTTGTGAGCTGCCGGTGGACGCCATCGACTCTGCATCTGACACGGGGTCCTCCTCGTACTCACC
AGTGTAGCCAATCGTGCCAAACCTGTCGAAAAGGATGGAGAGCGTCTCCAAAACGGTAGTAAAGTCGGCCCCTGCGTCCAGTAGGTCGTCAGGCTGGAAG
ATTTCACCCTCGTTCAGCCCCTGCTTCTTGCACCACTCGAGAAACAGGCGAATATTGGCCTTGGAGTGGAAAACTGTGTTGAGCTTGTTCACCTTGAGAT
TGGCCGTCGGATCCACGCCGTTCGCCAGGAGACAGAGCAACTGGCCATCGCGTAGCATGACCGACAGGTGCTCGCCATGATCGTTGGATGAGGCCGTGAC
GCTGCAGATCCACTCCTGTAGCTCCTCCGTGCGACGCACCGTCATGCTGGAGAAGGATGCAGAGAGACCAACACTCCCGGTCGCGTCCGTACGAGCTGAT
AGATGTTCCTGTGTCTAGCTACAAGTCCGAATAGACTGGATAAGACGAAGAGGAAGGGGGCGAAGGCCTCGACACCTGACACTGGACGATGTGATGTCCC
TGTTGCCTCTCGTAGTAGCGCGCGAGTTTGCGATAGAGCGGCTTCCGGGCAAAGCTCGAACTCCCTCTCGGCACGCGACGGAACACACAGGAGATTTTCC
GCACTGCTTTCTCCAACGCCGCTGCACACGACCAGACACGCTGATACTGGACCGTTGACAAAAAGCTAACTGACTCCAACGGCTGCCAATCGAAGTGATG
GTCAAGTGACAATTTGCACGCCAAAAAAGACTTGAAAAGACTATGGGCTCCCTAACCCAGGCGTCTCTACTGTGCCTCCCATACGAAAACCAACATGTCG
AGAGCAAGCAGCTGGTGGGAAAGACGCCTGAGACCGACGATAAGGCGACAAGGTGCAGTTTTGCCTTGCCTTTGTTTGCGGGGTGTTTGCTTGCCAACAT
GGCACATTTTGCGTCGCTAAATACGCACATTTGTGCCTGGATCCGGCTTCACAAGGATGAAGCTGTTTAGTTTGAAGTGAACGTGTCGAGTGGGTGCATC
ATGTCGTTCGCGGAAGCCGCTGCATGGGAAGTGAGGGCTCTACAACCGCTTGATCAAGTGTTTAAATTTAAACACACATGTCATGTCGGTATCCGTTACT
ACATGTTCTCGCGCTTGTGAGGGTCGTCCAAGTCTATGGACTTCAGAGCCTTCACATGCCGCTGGCAGTGGAAAACTCTGGGCTGTAAACAGGAACTCGA
ACAGGAACTCGACTTGCAACTGGATACAACCGTCACTCACCACCACAAAAACACCAGCGATAACCCCCAAGCCACCCCGAGCGAACCCAAGTCCAGTCGC
TAGTTGCTGTACCGAAATCCAACTGCCTTGAGAATATCCGCTGGCGCTGACGATCTGCACCCCCAGCCAGCAATCGCCACACATTCTTGACTTCTTGGTG
AAGTGACGCTGGCAAGTGTAATGCATTGCATAACGACAAGTGCTCTTCTCAGAAGAGTCTTCTGACACCGAGACACACGAATACAGACAAAAACGCACTT
GTGGCGGAGCAAACTCATCGAGAAAAGAAAGAAAAATGCACCAAAAATTGCCACACTTCCATCAAATGCAGCCACATATTCATCAGCCAATCATTTGCCT
TCTTGAAGTTGTTGCCCTAGAAGATCGCAACGTTCCCAACCACGACCACGATGCAATTCCTGCTAATAAGCTTACTGTTGAGCTTGGTGGCCCTGCTGTC
CGTGGTGCAAGCTAGCATCTACACAGGCTACACTGTGGGCCGGCAGTTCCAGTACATCGGCAAGTTCTGCTTCACTTGGACGCCTACGCTGGACGAAATC
GCGGGGGTTCGTACAACTGAAACCTGAAGGAATATTAATAATGACAATGCTCACACTAACCATTTGGCTGTATCCGCCAGCGCATCACAGGTGAAATCGA
GACGGATGTAGACGGACTTCAGGTGGCCATCTATGATGACGAGGCGCTCTTCTGGAACTACGTCATGACAGACAGCTCCTGCGACTGCAACTGTAAAGTC
TCGGCTCAACACACCAAAGGTGTCTTCAACGTTACTGCAATCAACAGCCACCACGTGACCCCGTTTACCTTCAACGTAGATATTCACCAGCACCTACGAC
CGAGGTTCTGGTACGTGGCGCTCGCGCGTTGCGTCCCAGGAGGAGACCAGTACAAACCTTCATTTGCGGAGATCACGGAAACCAATTTCCGCAAATACTA
CTTCTCATCATGGTTCAATATCCACATGACCCAGGCGGATGGGAGCGAACTCCCTGTCCAGCAGCAAGGAATGCCGACGATATATGCCGTCATGACGGCA
GTGGCGGGAGCTGCAGCGGCGGCACAACTTGTGGCAGTACGGGGCATGACAAGGAGCGAGTCGTTCCACCCAATCATGCGGATCCTTACGCTGGTTGTGG
TGTTTTTCTTCCTGTGCAACGCCCTGCTCTGCATCCACTTCACAATGTACCAGTCTAATGGTGTGGGAGTGCCGTTTTTCAAGTACGCAGCCAATATCAC
CGAAGTTTTCGTCTGTGTGGGCACACTACTACTTGCCATGGTGATCGCGAAAGGATGGACGATCAACAGCGTCGCGCTGGACGGCCAGATCCAGCTTTCG
TGCGTCATACTGGCCATTCTCGTGCTTTACTTATCGATGGCGATGTGGTATCTAGTGTGGCTTGATCCGGCCTCGACACTTTACATCTACGACTCGTGGC
CAGGTCTGGGTATCTGCCTACTACAGATGTGCGTACTCGGGTGGTTCATCAACACAATCTTGGAGACGCGTTCGTATGAGAAAGCCTTGATGAAACGGCA
CTTCTTCCTACGAGTAAGTGCTCGACCTGATGCAAGTTGCCGAATGGATTTTTTGAAAATGCTCACTCGTTGGTTCCAGATGTGTTGCCTGTTCTCGGTG
TTTTTCGTAGCGCTGCCTGTCATCGTGCTCATCGCATCCTTCTTGTCGCCATGGGTGCGAGAGAAGACGGTGGCTGCTATAACGACCTCATTGCATTGCT
TTATCTATTTGATACTCATCTACATGCTTTGGCCAACGCGGGCACCACGGGACTTCGAGGTACGTTGCAGTGGCGAGAGACACAAAGCCGTGATTAACAA
ATTATGTTGAATTGTACATGCAGCGTCTGTACTCGGTGTCATCACCGTCTGAGAAAGCATCGCTGCGTGATCAGCATCTCCCCACTGAAGAACTCTGAGC
CACTCAGCAAGATAGATTGCCTGCAAGTAGTTTCAAACGGTCCGTACGAAGGCGTAGATAGTGACATTTTCGTTTTAGCCCACTTCTACATGATGGTCCT
GTTGAGTTGCACTCTTGTCTTCCAGTAAAGTGTAAGTGTTTGAGTCTCTAGGTGG