Description :
From Genome Similarity Track
Location :
Scaffold_837:955- 3307
Transcript NameFunction/comments
Phyke_g11170hypothetical protein

Sequence
2352 bases(100 bases per row)
CGAAGGAGGGAGACCGACTGCGCCACAACATCGGGAAGCTACCAGGCTGGGAAGTCATACGTGCAGCGTCAGGATACGCCCTCGACCTCACAGTCAATGA
GGCAGAATACCGGGGCATGCTGCTTGGGTGTTCACTCCTTGAAGAGTTAAACGTCTCGAGACTGATCATCTGTGGGAACTCGAACCTTGCCATACGACAG
ATGCGGGACGAAATGGATTGTAAGTCACCGGGCCTGAAGTTGCTTCGACAGCGAGCCCGGAACGCGCTACGAGAGTGACCCCGTCATGCCTTATTCCACG
TACGTCGGGATTGGAACGCGAGTGCCGATATGTTGGCTGGACAGGCGTTACAGCGTCAAGGCGGTATAGAAGTCCACAGCCCGGAAGAGATTTGAGAGCT
GAAGGTCTTAAATCGTCTGGAAGAAAATGTCCGACCTAAAACACCCGATCCAGAGCATCTGATGAACTATCATGCCGACGTGAATCCCGCGACACCCGAT
TTGGCCCAGTCGATTGGAAATCGCACCGACGAGCAACTAGGGGCGGCACAGGTTCAGGCAGTGACCACCcggtctgctgctgtacaGGCTCCGTCGACCC
CGTCAACCCCGTCGACCCCGATCAGAACACCGGAAGTTTGCCAGGAGCTGATCGTACAGCGACTCAGGCTAGATCGGATTCGAATTGCCCAAGATGAAGA
ATTGTGGATCGCGAATCTCAAGAAGTACATAAACGGCGACGTCGGAGGACTCTCCAAACGGGAAGCAAAGttctgcagcaagatcgcACACCAGTatgag
gaaggtgaaggtggccTACTGTACTACCACGCAAAGGGAGACGAGTCGGCCGAAAATCGCGACACGATCATGAAGCTAGTGGTCCCGGAGATGCTCCGTG
AGGATATCCTACACCACTACCACGCGAGCCTGGAAGGCGGTCATCAGGGAATCGGCCGGATGTATCAACGGCTGCGACGCCACTTCCACTGGCCTGGGAT
TTTCAGGAGCGTGCAACGCTTTGTGGGCGAGTGTACGGACTGCGAAACCGGCAAAGGGAGACCGACGATCCAAGGCGAATCGCCGGGCAACATCGTGGCG
ACGTATCCGTTCCAAGTCGTGGCCATGGACCATATCCCGTCTTTGCCCGCGTCGTACAAGGGTAATACCGAGTTACTCGTGTGGGTTGACTTGTTCACGG
GTTTCGTCATCGTGAAAGCGAATGCGTCACGAACCGCGCAAACAGTCGCGGAAGCGTACGAAGAAGCCGTCTTCAGACGGTTCGGAGCGAGTGAAGCGAT
TCGCCATGATCGCGAGCCAGGCTTCATGTCCGACTTCTTCAGAGCATTCAACAAGCTCATGGGTCAGCGACAACGAGCAGCGCTTGCATACAGGCCCCAG
GCaaatggtgctgcagaacgcATGGTACAAACAATCACCAGGGCCACTAAGATGTACATCGCGGATATTGATCAACGAGACTGGGACGAATACGCAGAGC
GACTTACCTTTGCACTAAACACGGCACACGACCGCACAAGGAGTGAAACCCCGTTCTACCTCGTGCACGGCTGGGATCCGAGGTCCACATTAGAGGAGTC
ACTCGCTGTCGGTAACACATCGCACCGCGACGTGGAAGCTAAACACTGGAGGTTGCGTATTCAACGGCACTACAAAATTGCACGAGCCCAAGCACTGGAG
CGGATCCAAGACGCGGTCGACGGGAGAGCACGACTGCAGAATGGAATCGCGACCGAGCACTCGATCGAGGCCGGGTCACAGGTGTGGCTGTACTTAGATA
GAGTGAAACCGGGGTATGCAAGGAAACTGGCGCACCTGTGGCACGGTCCATTCCGAGTCACAGAGATGGTGAGCGCGTATGCTGCACGAGTGGAACGCCG
TACCAGTTGCACCCGATCGTGCACATCTCCAAGCTGAAGGCTGTGCGGAAATTCCCGACACGACCTGAGACGCAACGGACGGTGATCGATTCGattttga
tgaagaactcCTCCCGGAGGATAGCTGGGAACTTGAAGATCTGGGAGAAGATGTGTTTGAAGTGGAAAAGATCGTTGATGTGCGAGAAGGACGGACTACG
CGATATGGTCGTTTGCTTCGCGAATTCGAGGTGAAATGGAAAGGCTATCCGGATACGACGTGGGTCGACGAGCTCGATCTTAACTGTGGAGGGCTGCTGT
ACGACTTCTTACGGCAGCGTACGGGGCGCAACCGGCTTCAGGTGATGCAATCTCAGGAGAACAGGGAGATCGCCGGGGCTAGGCCAGAAGAGTAAGCGTT
TTATGGAAGCGCGGCGTAAGTCAGCAGGGTGGCTGCTGACAGGAGGAAAGGT