Description :
From Genome Similarity Track
Location :
Scaffold_1731:955- 2138
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1731-abinit-gene-0.4HECT ubiquitin ligase

Sequence
1183 bases(100 bases per row)
GTTAATCAGTCGTGAAGCCGTGCAACTCGGTGTCGAGGATGCTGTAGATTGCCATTTCGAGGAGTTCTTTCGAGTCGAAGAGCGGTACATCCAGGCGGTT
CAAGCACGCGCGACTCACGATGCACGACGCGGTGATGCATGCCGTGGCTCTGTCCCACATCACGCCGTTCAATGTGAAGCGGCACAAGCGTCCATCGATG
CTGGTTAAAGCCGCAAAACCGCCGATAGGAACTCGACTCGACCCAGTCGCAAAGTGAAGCAGCCGGCGACGATATTCGTTGGGCATCTCGCGAACGATCG
CCCAGAACCACTTGAGGACGTTGTGGGGCTGCAAGTTTGCACTAACGACAGTGTGGCGCTCCCAGTCGTCCACGTCGATCTCCTGTGGGTCGCCACAGAG
CACGTAACCCAGCTCTTCCGGGTCAAAAAGCATGATAACTTGTGGTGGAATGACTTCGTAGATCCCCTTCAGGAACACGTACAACTGACTCGCCACACTC
TCAAAGAGCAAGTACCGGAATCTCCGCTCCAGGTACAGATCCTTGTTCTCGTCCGTGACGTCAATATTGCGGCCATTCTCGATCAAATCGATCACGACCA
GGCCGTCATCACCTCGTTTCTCCGTCATGCTGAAAGTAATGCCTAGATCACCCACGCCGTCATTCTCCATCATCCACAGCATACTCTTGTACGCTTCGGG
GTCCATGTCTTCCAAGTCACCAAGAGTGACTGGTATCCCTAAGATGATCTTGAGCAGCGGCAACGCCAAGTGGAAGTTGAGCACGTGGCCTTCCAACAGA
GCGCGACCAATGAATCGACCCGTTGCGTAGAAATAGAGCAGGTGATCATTGCCAATGTCATGCGCCGAGTTTGGGTTCAGATAGAAAATTTGCTCGGTCA
TGTCGACACAGCGAAATACTCCAGTCGCTGGGTCCGCGAGAGCGAGGTTCAGCAGCATGAACCACTCTCGCTGGAGCCCGCCACCGTCGACGCCCTGCTC
GATGGTAAAGTTGATCCGCATCGCGGAGCGTACGCTGGGCCGCGGGATGGCACTCAAGGCCTCCATGGAGTCGTGCACCAGGTGGTCGCGGCGAATGTTC
AACTTGACATACTGGCGACTGGCATCGCCAAGCAAAGTTGCTGTCTTCGCCACAAAGTGCGCGTACACGGTCGGGAAATTGTT