Description :
From Genome Similarity Track
Location :
Scaffold_158:95478- 102938
Sequence
7460 bases(100 bases per row)
TGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGAGGTCGC
CCAGACCTTAACTGAAAAGGAAGGCGCTGAACACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCATT
GAACACACTTCCTGTGTGGGTACAAGAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCACAGCTCCCC
GTCACAGACGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGCTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCG
GGCTCCTCTGACAAGGCCGATGGAAGAGTTTTATCACAGCTTTGATGGCGAGACAGGTTTACCCGTCAGGGCATCTGGTGTCCACTTGGAACCGTTGTCA
GAGGTTGCAGAGATACTACACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGGAGAGATTAGCTGAGATGGTACTCATGAGACCT
GCTACCACTCAGGAGGAAGCTGAACTCCTTCTTCTGTATTGGGCGAGACCGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGGCGCTTGGGATCCTGAG
ATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTACGCGGACGTGGTGAACCAACACCCACCGACCCAACTCCCACCGGATCGAGGCG
TACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGTGAACAGTGCGAGGTCATGTATGCCTTCCTCGC
CGCGAAAGCGAAGGCAGGCATGGAAGTGCGGGAGTCGAAATCCCCGCACTCGACGCAGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTT
CACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCGCGAAAGGATGTGTTGTGGAACAACATGGCCGGGAGCGTACTGTATA
GTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGCGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAATG
TCTCGTCATGCCGCAGGGCTTGTCTAACGCCTCGGTGACGCTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTC
GACGACATTTTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCAAACA
AGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAA
GGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTAC
GCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGTACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTC
TCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCGTCGGATGTGCATTGCTGCAGGC
CGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGCCCATGACAAGGAGCTCCTGGCAATG
AAATATGCCCTTGTGAAGTTTTGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTC
ACCTCTCTCGAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCT
CTCTCGGCGTCCCGACTATGCGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCAGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCG
CCTCTCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGCCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGACACAGGGCC
TCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAGCGACGAGGATCTGAAGTTCGACATCCTGGCGAAGGCGCATGACGCGCC
CTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACA
TGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACT
TCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGGATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGCACATCTTGCTCCAGTTCCCGTCAC
TGTAACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACT
GCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATT
GAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCA
CGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGG
GGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTG
TCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGCGGCTGGGGA
CTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAACGGAAGCACCGCTTCATCGGACCTTGTGCAGTTTTG
GCCAGACATGGTGCGTCGTACACCATCGACCTTCCCAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGG
GGGTGGCTGACTCGCAGTCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGGAGGCACCTAAGCCTCGGTCG
GGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGAACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACC
ATACGCGTACGTCTGGGAGTGTGGCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCGTACGCCCTCTTACCAGCTAGCGCCTCGCAC
ACACCTCTGTCTAGCACCCACCCAGCCTTTGAACTCGGCCTCTTAACGTTGACGAAAGCGTGACACGAAATGGTGTCTACAACTTCCGTGTACAAGGGTC
AGTGTGCCACCGCATGGGATTGTTAGTACCTCCTACCTTCGGTCGCTCCATGTATGCCCAAGTTTACTTTAACGATCCACACATGGATGCACGTGTGAGA
AGCCGTATGAAAATGACGCAAGGCCTCGATCGCGCCGTCATGGAAACGATTGACCAGATGATGGTGGCGCACAACCCGTATACACAAGCGTTTATCAACG
CGCGTAGATTTTTGATAGATCGTGGTTGGGATGCGTATGCAGCAGCCATCAGGGAGCACGAACGACGCCGAGCGGCAGGGGAAGACGTTGATGAGCATGA
CCCGTCGTTAGCCTTGAGTAACTTTCTTCCGGAGGGGGATCACCTTAAGCTGCGCCTGCATGTCACACGGAATGCGAACCCGGGTACGAATAACACCCCA
ACTGCATCAGAGGTGGCAGCCGCTGTAATCGATACAAACGCGGCTGACATCGGGATCTAATCCTACACACGACAGATGGAGGTTTCAAGCGCATCTTTGA
GACGAGCGTTACCTACGACCCACTGCAGTACCCTCTACTGTTTCCCAATGGAGAGAATGGATGTACTTGCGATATCCCCTACCTTGGTAATCCCGTCGAT
CGCCACGGTGACCCCTTAACCATGTCCATTCGGGAATATGAGGCGTATCTGCTTTACGACCGGACGGTTAGTAACTCTCTAGAGACCACCCCGGGTCTCG
GGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTATT
TTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCACCCACAAGGCCACGAGGAGCGACGAGAACCTCCAAGAAGAGGTCAGCCCCAGAGC
TCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGGCGGGTGCCGCCACCGAACCCCCACGCACACGCTGGACAGCTTGGAAATC
CTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCTTCCTCCTCTTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAG
GAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGGCTTCGGCTT
TAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAAC
GGCCGGACTCTCAGAGCGCACAGAGATCCTGGGACTGTGATCACCGTGATCACTAGCGGGCGACTGCACGCTGTCGTCTTTGTGCTCACTGGGCACTGGG
CTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGT
TCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGATTCGATCGCTTCGGAGGCCAC
CTCAATAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGATTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTC
TTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTAGACGGAGAGCGCACAGGCTGCTTCTCGAGGCTCTTACTGTGAAGTAAGCCTCCGCC
GCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTAAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAATTGAACCTAAGTGGG
GGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAAGAGTATGACACGTCATACTCCGGGATATTT
GGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTAATAGTTTGTATTAAACCCAAACTTAACCTAC
CTATAAATATACTCAGTTTACAATTTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTAT
ACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACATATCTTCTCAAATGCCGTAAACGCGTAGAAATTTTGCTGATTTCGCGT
TTATGATAGTCAATGACGTGGAAATGACAAAGAATCACTGTAGCCTCAGGTAGTTCTTCTGCTAGTACGCCAAGTTCAGTGAAATCCTTATCAATAATCA
CCACCTTGATATTATCCCACGCTGGATTGTTCTGTTTAAATGCCTTGAACGCACTCTTCATGTTAGGTTTTGTCTCTCCGTCAATCAAGGCATGCTGAAC
AAACGCCCCGCTGCCAAATTTATATCTCACCATGAAACTAAACAACCGATACCTACATCAAATTCATAGCTAGGAATTGGTGAATATGAAACCAATTCCT
ACCTAATTGGTGACATCACCTAACGTGTTGGTAATTATGTCACCAATTTATTAACTGGTGCTCACATCGTACCTGTTAATGTTTGTGCCGTGTGTGGCAT
CTATACAAAGTGCTTCTGGGAATTTGCGAGCCATCCTTTTCATATGTGCTGTCTGGAAGGTTATACAGCTCGTCAATTCGGAACCTGGATCGCGATAGAT
ATTGACAGCCGTTCCTGGACCTTCACTGAAATCTTGCAGCAACTGTGAAACACGGACATTGTCATCCGCCGAGGTGTATGTTTCGCGTCGCATCTGAGCA
ATCATGTTTTCGACGTCCTTTGGCTAGATCGGTTTTCCGGATGCTTCTTTTAAAAATATCGCAGAATCGTTTTGCGGTTGGACCCACCTATAAGACATCA
TGTTAGCAAATGACCAGCTATATATTGTACTACTGTTGATCTTACCTTGCCACATTGTTTTAACAACAATCTTGGTGTCAGGCGAGTCCACCTTGCGAGT
CTCAGCGTACGTGAAATACTCTTCAGGATTAACGCTATGGTTGTGGACCGACATGTGCTTTGAAACACATACCGTGTACACTCCGCCTTCGTCTTGTTTC
AGGAGCGCGTTCAGTCTCGCCTTACACCCAATCCCTCGAACAGTGTGGTTTGTTCTGATGCCTTTTCCACGGGGGTTAAACTGCCAACCGTGAGTGCAGA
TAAAGGTCTTCGAGTAGAACACCAATTTCTCGTCGTACAGAACAGGCTGTGTACCTGTCAAAGCACAACGTTTACTTCGCTTATGATTCCGATCACGTAC
AGAGTTACTCGTTCGCAACTTGTAAATCTGATGACTGTCCTTCTGGTACCTACGCGTGAA