Description :
From Genome Similarity Track
Location :
contig_2:954682- 958696
Transcript NameFunction/comments
g726.t1hypothetical protein

Sequence
4014 bases(100 bases per row)
GGTCGTGTCATCAAAACGTTCAAAATTGAACCGTTTGATGGCTCCGTTGAACAAGGAGCGATTGACTCAGGAGTGGCCACGTGGTTCACGCGCCGAAGCG
CTACTGGAGATGCAGGAAGATCTCCATCAAGTACGCCTACCAGAGTGTATGAAGAACGCCCTGATCTTTCAGCATCTAAGTGGCGCTGCCAGCCAATGGT
ACATCTCAAACCTATCGGATCTTCGCTTGCGCACATTTACCAGTCTTGGGCGAGAGTTGAAGCGGGAGTTCGGCAGCAAGTTGTCCAAGGCACAGATTGG
ACAGTTAGTGGCAAACGAGAAAAAGGAGAACTCTGAAACGTATCGTGAGTACTCGTTACGCCTTCGGACCATGGCTGCAGCAACCTCATCAGATGGTTTC
GAGACAAAGGACTCAAACAATTTAGCGCTCAGTTCTTTCATTGTGAACGCTTGGCGCAAGCACACTGACAACTTGCGCATGGTCATCAGAGAGGACTCGA
GTCACCCCGTGCGTGAATTTGATCGAGCTATCTCGCGACTGTGCACAATCGCTGGTCATCAAGGCGTTCTATCTTTCCCGTCGCGACAGTCTGCACCAGC
CACAAAATTACAGCCATCCAACACTAGCGCTAACGCAAAATCGAACCTGGGGAAGAGAAGGGTGGCAGAAGGAGAAATCAAAAGGGAAGGTGCTTTCAAG
AAACGAGATTACTCAAAGATGCGCTGCGGCACCTGTGGAGAACTCGGTCATACGACAGGTTTTCATGACAGGTATGTGGCGCGTCAGTCGAGTGGTATGG
CTTACCTTGCCAGTGACAGCATTGACATCAAGTCAAGTGATCGTGGTGACGTGCAAGGTGACAAGGGCGGCGAGCCAAGCTCTTTTGACTGATGGTCGAG
GGAGCCATCGGACCCCAAGGTTCACGTATTTGACCCTGGGATTTCCGATGGTGCCCCGATCATAGATTCCGGCTCCACCTACCACGTGACTGGAACACGC
AACAAGCTTTTTGATCTTCGAAAATGCGAGCCACAGGCTGTTGAAATTGCTGATGGAGCGTTAGTGTGTGGCAACCAAAAGGGGAGGATGCTCATCGACA
AATTCACGGACAAGGAGTGTCTAATTTATGACAAACCACTTATGCGAGGATCTGTTCAGCGAGGTGTATACACTTTGGACATTCCGCCAGGCATGGCAGC
CTGTGCATTGCGTCCGAACTCAATCGAGGACTGGCATCAAAGGCTCGGACACTTGAACTACCGCTCTGTCGCTGAATTGTCAAAGTCTGATGCTGTAAAA
GGGCTCAAAATCGTGGGCTCTCTTCAACCCTCAAAGCCTTGTGAAGTGTGCGCGCAAGCAAAAATTTCTCGTGCACCCGCTCCACACCAAGCCTCAAGAC
CACTCGATGCTCAAGATGAAGTCTGCCATGGAGATCTGGCAGGCCCCTTCACAGCAAGCTATCATGGCAACAGGTATTATTACGCGCTAAAGTGGAAGGG
ACACACAACCGTGTACTTCATCAAGACCAAGAGTGAGGCTGCAGTCTGTTTTCAGCACTACATGAACATCGTTAATCGACGTTTCAACAGATTGGACGGA
ATCAAAGTATACAGATCCGATAATGGTGGTGAATTTACAGCTGGAGACTTCCGAATGGTTTGCGGGGGTGAAGGAATAGCGATGGAAATGTCTGAACCTG
ATGTTCATCACCAAAATGGCGTCATCGAGCGAACACATCGAACCATTGCTGATGCAGCTCGTGCACTAATGTTACAAGCTCAACTCCCACATTACTTGTG
GGAATATGCCATTCGAAGTGCCGTGTATTCCCGAAATCGAGTTCTTTCTCGCTCCGACCCAACCAAGACGCCCTTTGAAACGTTTTGGGGGAGAAGACCC
GACTTAAAGTTAATCAAAACGTTTGGCCAGCGCTGCGTTGTACTTATACCTCCGGAGAAGCGATCAACGGCTTATAAGTTTCGACCTAAAGGCAGGACGG
GCGTCTTCATCGGGAGTGACCCTCAAAGAAAGGGATACTTTGTGTACGTTACGGGACACGGTAATCAAGTGATACACAGTCGAAGTGTGATTTTTCTGGA
ACCACCAAAAGCCAATTTACCAGCGGAGTATTCTGACCCAAAAGATGACCCGTTGCTAGTTGTTCCTGATAACTGCGAGATCCAATCGGAATACGAGGAC
ATCAATAATGTAACTGATGAACCTAGATCCCCAAGACGTGAATTACGAGTTGCTGGCAACACAATGCGTGACTCCGTGGGACCTGGCTTGACCCCACACC
AAGTGGCAGCTCTTAATGGTTTTGAGATACCTACACATCTTCGGCGATCAGAACGTATTGCAAACAGATCACTCGGTCTCGTACTCAGCGCTGCTCATGT
CACACTTCGTGAGGTAATTCAAGAACCCCTGAATTTAAAAGAAGCAAAGGCCTCCACTGAGTGGCACCTTTGGGAACAGGCCATCCAGGACGAAATCAAA
GCTCTTAGGGCAAACGATACTTTTGATATCGTCGAACCGCCAGTTGGAGCTCACATAATTGGGTCAACGATCGTATTCCGAGTTAAGTTGGGCGAAAGTG
GGGAAGTCGAGCGATTGAAAGCACGAATCTGCGCTCAAGGCTTCACCCAAGAGTTCCTAAAAGATTATTTTGAAACATACACCCCGGTTGCCAAGCTGAA
CTCCATCCGTGTATTTCTTGCGTTGGCTACTCAAAAAGGGATGCGCGTACGCCAAGGCGATGTTCCTACGGCGTACGTCAAGGCAGCGTTGTCCGAAGTA
CTTTATGTCCGGCAGCCCCGCGGGTTTGAGGAAGTAAGTCGATCCCATGTGTGGCGACTCAAAAAGGCATTATACGGCCTTAAACAAGCCGGCCGGGAGT
GGAATGTGGAGCTCAACAGTTGTCTCATCGAGTATGGATTGTGTTCAACAAGGGAGGATCCATGCGTGTACACCCATCCAACTAACGAACTAATTGTTCT
TATCTACGTCGATGATATTCTAATAGGTTATCATGATGAGCAGGTACTAGAACATTTGATGCAAGCTCTTTATTCCAAGTACCAGATCAAAGATCTTGGA
GACGTACGGTGGTTTCTCGGGCATACGCATAAACATGGATACAGCTCGTGGAATCACCACTCTCGACCAAACCCAATTCGCATCAGAAATACTGCGACGT
TTCGGTATGGAAGATTGTCGACCCCGAAAGACCCCGTTAGATCAAGGCACGATTTTATACAAACGAACTCAACATGATGATGAAGATCAAGAAAACCCTT
ATCGACAGGCTGTCGGAGCCCTTCTCTATCTCGCGCGCGTTACCAGGCCCGACATTGCATTTGCGGTGAACCAGGTTGCTGCTCATGCCTCAAGTCCAGC
TCAGTCTCACTGGATTGCCGTGAAAAATATTCTCAGGTACATTGAAGGAACCAAGAACATGGGCTTGATCTACAAGAGAAATAAGTCAACTGTCCCCGTC
AGAGTGTACACGGACGCTGACTGGGCCAATAACGAGGAAGATCGGCGATCAATCTCTGGAGTTCTCGTTCAAGTTTTCGGTAACTCTGTGTCTTGGCAAA
CAAAACGACAACGACTTGTTTCCAAGTCCTCTACAATTGCTGAATACATTGCAGCGGATGATGGAGTAGAAGAAGCATTATGGACACGGATGCTGCTTCA
AAGACTGATGAAAACTCAAGCTCTCGACGCAATTCCAGCGATGATTGACAACAAGTCAACCATTCAAAGACTGTTAAACGGAAAAAATTCCGAGGCACAA
AAGACAGTTGATTGTAGCATCTTCTCGATACGGGATGCTATCCAATCTGGGCATCTACAGCTCAAGTACTGTCCAACTGCAATTATGTTAGCTGATGGAC
TGACCAAGGCTCTTGGATCTACACAATTTAGTGAACGCCGTGAAGCAATTGGCATCGAAGAATTGACATCCAGCGCTGGTGGGGAAGTGTTGAAGTAGCC
AGCCTGAACTTATC