Description :
From Genome Similarity Track
Location :
contig_2:954668- 958680
Transcript NameFunction/comments
g796.t1hypothetical protein

Sequence
4012 bases(100 bases per row)
GGTCGTGTCATCAAAACGTTCAAAATTGAACCGTTTGATGGCTCCGTTGAACAAGGAGCGATTGTCTCAGGAGTGGCCACGTGGTTCACGCGCCGAAGCG
CTACTGGAAATGCAGGAAGATCTCCATCAAGTACGCCTACCAGAGCGTATGAAGAACGCCCTGATCTTTCAGCATCTAAGTGGCGCTGCCAGCCAATGGT
ACATCTCAAACCTATCGGATCTTCGCTTGCGCACATTTACCAGTCTTGGGCAAGAGTTGAAGCGGGAGTTCGGCAGCAAGTTGTCCAAGGCACAGATTGG
ACAGTTAGTGGCAAACGAGAAAAAGGAGAACTCTGAAACGTATCGTGAGTACTCGTTACGCCTTCGGACCATGGCTGCAGCAACCTCATCAGATGGTTTC
GAGACAAAGGACTCAAACAATTTAGCGCTCAGTTCTTTCATTGTGAACGCTTGGCGCAAGCACACTGACAACTTGCGCATGGTCATGAGAGAGGACTCGA
GTCACCCCGTGCGTGAATTTGATCGAGTTATCTCGCGACTGTGCACAATCGCTGGTCATCAAGGCGTTCTATCTTTCCCGTCGCGACAGTCTGCACCAGC
CACAAAATTACAGCCATCCAACACTAGCGCTAACGCAAAATCGAACCTGGGGAAGAGAAGGGTGGCAGAAGGAGAAATCAAAAGGGAAGGTGCTTTCAAG
AAACGAGATTACTCAAAGATGCGCTGCGGCACCTGAGGAGAACTCGGTCATACGACAGGTTTTCATGACAGGTATGTGGCGCGTCAGTCGAGTGGTATGG
CTTACCTTGCCAGTGACAGCATTGACATCAAGTCAAGTGATCGTGGTGACGTGCAAGGTGACAAGGGCGGCGAGCCAAGCTCTTTTGACTGATGGTCGAG
GGAGCCATCGGACCCCAAGGTTCACGTATTTGACCCTGGGATTTCCGATGGTGCCCCGATCATAGATTCCGGCTCCACCTACCACGTGACTGGAACACGC
AACAAGCTTTTTGATCTTCGAAAATGCGAGCCACATGCTGTTGAAATTGCTGATGGAGCGTTAGTGTGTGGCAACCAAAAGGGGAGGATGCTCATCAACA
AATTCACGGACAAGGAGTGTCTAATTTATGACAAACCACTTATGCGAGGATCTGTTCAGCGAGGTGTATACACTTTGGACATTCCGCCAGGCATGGCAGC
CTGTGCATTGCGTCCGAACTCAATCGAGGACTGGAATCAAAGGCTCGGACACTTGAACTACCGCTCTGTCGCTGAATTGTCAAAGTCTGATGCTGTAAAA
GGGCTCAAAATCGTGGGCTCTCTTCAACCCTCAAAGCCTTGTGAAGTGTGCGCGCAAGCAAAAATATCTCGTGCACCCGCTCCACACCAAGCCTCAAGAC
CACTCGATGCTCAAGATGAAGTCTGCCATGGAGATCTGGCAGGCCCCTTCACAGCAAGCTATCATGGCAACAGGTATTATTACGCGCTAAAGTGGAAGGG
ACACACAACCGTGTACTTCATCAAGACCAAGAGTGAGGCTGCAGTCTGTTTTCAGCACTACATGAACATCGTTAATCGACGTTTCAACAGATTGGACGGA
ATCAAAGTATACAGATCCGATAATGGTGGTGAATTTACAGCTGGAGACTTCCGAATGGTTTGCGGGGGTGATGGAATAGCGATGGAAATGTCTGAACCTG
ATGTTCATCACCAAAATGGCGTCATCGAGCGAACACATCGAACCATTGCTGATGCAGCTCGTGCACTAATGTTACAAGCTCAACTCCCACATTACTTGTG
GGAATATGCCATTCGAAGTGCCGTGTATTCCCGAAATCGAGTTCTTTCTCGCTCCGACCCAACCTAGACGCCCTTTGAAAAGTTTTGGGGGAGAAGACCC
GACTTAAAGTTGATCAAAACGTTTGGCCAGCGCTGCGTTGTACTTATACCTCCGGAGAAGCGATCAACGGCTTATAAGTTTCGACCTAAAGGCAGGACGG
GCGTCTTCATCGGGAGTGACCCTCAAAGAAAGGGATACTTTGTGTACGTTACGGGACACGGTAATCAAGTGATACACAGTCGAAGTGTGATTTTTCTGGA
ACCACCAAAAGCCAATTTACCAGCGGAGTATTCTGACCCAAAAGATGACCCGTTGCTAGTTGTTCCTGATAACTGCGAGATCCAATCGGAATACGAGGAC
ATCAATAATGTAACTGATGAACCTAGATCCCCAAGACGTGAATTACGAGTTGCTGGCAACACAATGCGTGACTCCGTGGGACCTGGCTTGACCCCACACC
AAGTGGCAGCTCTTAATGGTTTTGAGATACCTACACATCTTCGGCGATCAGAACGTATTGCAAACAGATCACTCGGTCTCGTACTCAGCGCTGCTCATGT
TACACTTCGTGAGGTAATTCAAGAACCCCTGAATTTAAAAGAAGCAAAGGCCTCCACTGAGTGGCACCTTTGGGAACAGGCCATCCAGGACGAAATCAAA
GCTCTTAGGGCAAACGATACTTTTGATATCGTCGAACCGCCAGTTGGAGCTCACATAATTGGGTCAACGATCGTATTCCGAGTTAAGTTGGGCGAAAGTG
GGGAAGTCGAGCGATTGAAAGCACGAATCTGCGCTCAAGGCTTCACCCAAGAGTTCCTAAAAGATTATTTTGAAACATACACCCCGGTTGCCAAGCTGAA
CTCCATCCGTGTATTTCTTGCGTTGGCTACTCAAAAAGGGATGCGCGTACGCCAAGGCGATGTTCCTACGGCGTACGTCAAGGCAGCGTTGTCCGAAGTA
CTTTATCCGGCAGCCCCGCGGGTTTGAGGAAGTAAGTCGATCCCATGTGTGGCGACTCAAAAAGGCATTATACGGCCTTAAACAAGCCGGCCGGGAGTGG
AATGTGGAGCTCAACAGTTGTCTCATCGAGTATGGATTGTGTTCAACAAGGGAGGATCCGTGCGTGTACACCCATCCAACTAACGAACTAATTGTTCTTA
TCTACGTCGATGATATTCTAATAGGTTATCATGATGAGCAGGTACTAGAACATTTGATGCAAGCTCTTTATTCCAAGTACCAGATCAAAGATCTTGGAGA
CGTACGGTGGTTTCTCGGGCATACGCATAAACATGGATACAGCTCGTGGAATCACCACTCTCGACCAAACCCAATTCGCATCAGAAATACTGCGACGTTT
CGGTATGGAAGATTGTCGACCCCGAAAGACCCCGTTAGATCAAGGCACGATTTTATACAAACGAACTCAACATGATGATGAAGATCAAGAAAACCCTTAT
TGACAGGCTGTCGGAGCCCTTCTCTATCTCGCGCGCGTTACCAGGCCCGACATTGCATTTGCGGTGAACCAGGTTGCTGCGCATGCCTCAAGTCCAGCTC
AGTCTCACTGGATTGCCGTGAAAAATATTCTCAGGTACATTGAAGGAACCAAGAACATGGGCTTGATCTACAAGAGAAATAAGTCAACTGTCCCCGCCAG
AGTGTACACGGACGCTGACTGGGCCAATAACGAGGAAGATCGGCGATCAATCTCTGGAGTTCTCGTTCAAGTTTTCGGTAACTCTGTGTCTTGGCAAACA
AAACGACAACGACTTGTTTCCAAGTCCTCTACAATTGCTGAATACATTGCAGCGGATGATGAAGTAGAAGAAGCATTATGGACACGGATGCTGCTTCAAA
GACTGATGAAAACTCAAGCTCTCGACGCAATTCCAGCGATGATTGACAACAAGTCAACCATTCAAAGACTGTTAAACGGAAAAAATTCCGAGGCACAAAA
GACAGTTGATTGTAGCATCTTCTCGATACGGGATGCTATCCAATCTGGGCATCTACAGCTCAAGTACTGTCCAACTGCAATTATGTTAGCTGATGGACTG
ACCAAGGCTCTTGGATCTACACAATTTAGTGAACGCCGTGAAGCAATTGGCATCGAAGAATTGACATCCAGCGCTGGTGGGGAAGTGTTGAAGTAGCCAG
CCTGAACTTATC