Description :
From Genome Similarity Track
Location :
Scaffold_344:9545- 10807
Sequence
1262 bases(100 bases per row)
TGTTACCATACGGGGTAATATTCAGAAGCACTCACCTATTGGCTGATATGGGCCATCATGTCAGTCAGCTCTAGCGGTGCAATCAGTGATGAGCGTGCGC
AATGAGTTGTGAGCAAGAGTTCAGCATACATTTTGGTAGACACATATAATTAAGATAAGACTAAAACATAGGATAATAACTAGGACTTAATTATATTTAA
TACAGTTTTACTTTCTACTTCTATTGACCCCGTAGTTCAATAGCTAGCCTTCCTCTGCACGTACGGTGTACGTGAAGCTACATGCGGCACTTACTTACAC
GTTGCCAGTGTAAGTTGACTTGTACTGTGTCGGTACAAGTCACCAGTGCCCCGTCACACCTGGTAGCACTTTGTAGTCCGTTCAAGGACCGCAGCCCCCG
CATCCAACATGAACATGTTGGATGATGATGGTGACAACTTTCACATTACGCGTGAAAGTTACTCCGATTTGAGTGACATCCAATGGAGTGCGGTCGAACC
CGCCGTCTATGCCATGCTGTCCGCACTGGACAAAGATGAGCAGCATACCGCTGTCGCCAATCTCATACAACATGACCTTGACGAGTCACGAAAGAAAGTA
ACCTTGCTTCACCAGCAAGGTTCTCAACAGGAAGAGCTGTTGAGACAACAGCAGGCACAGACTGCTGTTCCCGGGTCGACGCACGTGCGTCGCCCCGAAA
CTTTGAAGATAGACATCTCAAAGTACAGAGAATGCGAGAAAGATTCCCTCTTGAATTGAACAACGCCGTAAGGGCTCGTCACATCGCTGATGAGCAATTG
CAAGTTGCATTTACTCAGTAGAACTTGGAAGGACGTGCTAAACCTTGGGCACTAGTTCACAAGTTGCACGACCCATACGTGTTTGGGTCGTTGGAGGTCT
TTAGGACCCGGATTAGACAAACGTTTGAACTGCCACGGGCTGAGTTCAGGGCTCGATCAGAGCTCCTAAAACTCAAACAGGTTAAGCGTGATGTGCACGC
TTACGCCCAACACATACGACTCCTTGCGAGTTGCATTACGGCCAACCCGGTCCATGAGCACACGTTGATTACGGTGTTCATGCAGGATCTTGCGGATGGT
CCCATCAAGACCCACCTGTTCTGTTTGGAACTGGATACGCTAGAAGACGCGATATCAACTGCGGAATAGGAAGACTTCAGCTTGAGACAGGCTCCTGCTA
GTCCGGGTTCATATCGTCCCCAAAGACGAAAAAAAGTCGGAGGTCCAGAACCTATGGACATC