Description :
From Genome Similarity Track
Location :
Scaffold_19:95438- 97109
Transcript NameFunction/comments
Physo_132060ABC transporter G family protein

Sequence
1671 bases(100 bases per row)
CCGTGCACTCTAAGCTGGCGCAACCTCACCTACACTGTCGACGTCAAGAAATCGACCAAGCACCCCGACGGCAAGAAAACCATCCTGACGAAAGTCACCG
GTCGGTGTGCACCTGGCGAGCTCACCGCGGTCATGGGCCCGTCCGGTTCTGGCAAGACGACGCTGCTCGACATTCTCGCCGACCGCATTAGCTCCGGTAC
CATCGAGGGAAGTATCTCGCTGAACGGCGAGAAGCGTAACGTGAGAACTTTTCGGGCCGTGTCGAGCTACGTCGCGCAGGAGGACTCGCTGATGGGGTCG
TTCACAGTACTGGAGACGCTCGAGATGGTGCAACCATCGTGAAACGCGTGCAGACGGTTGTCGACGAGATGGTGTGAGCACACGCTGGTGGGGGATAGGG
GATTTCAGGAGGTCAGAAGAGAAGACTGAGCATCGCCATCAAGCTGCTGTCGGAGCCGTCGATCCTGTTGCTGGACGAACCGACGTCGGGTCTGGACTCC
GCGTCGACGCACAACGTCATGGAGTTCGTGTCGAGGTTGTGCCAGGAGAACAAGACGGTCATCTGCACCATCCACCAGCCTTCGTCCCTCGTGTACGACA
TGTTCACCAACATCGCCATCATGACCGCCGGCGAGACGGTCTACTTTGGGCCGCGCGAGCTCATCATCGACCAGTTCTCGGGAGCGGGCTACACTTGTCC
GATGTACATGAACCCAGCCGAGTACTTCCTCAGTCTCGTCAACTCCGACTTCACTGGCCACGCTGACATCAAAAAGCTCGTGCAGCGCTACGCAATCAGC
ACGACGGCCTCCACTATGCTGCAGAGCATCGAGGCCGACATCGCCGGAGTTCATAATGCTGCGCCGGTCCTCCCGATGAAACCCCCAGCTCTCCGCCAAT
TCTTCGTGCTCTTGGAGCGCAACTCGATCAACAACGCCCGCAACCCGGGCATCTACTGGGTCCGACTGGCCATGTACATGTTGCTGTCCTTCATGGTGGG
CACCATGTACCTCTCCACCAACGACGACATCTCCGAGCAGGATATGGTGCCGCTGCTGTTCTACGTGCAGACGTTCCTGGTCTTCATGTCGGTGGCTGTT
CTACCTTTCTTCATGGAGCAGCGCGCGGTGTTCATGCGGGAGCGCGCCAACAGCGGCCTCAACGTGTTCAGCTACGTGGTCGCCAACTTCATCGCCACTC
TACCGGGTATCTTCCTGATCGCAGCGGTCTCGACGTTCCTGGTCGTGCTGCTCTCGGGTCTCCACGGCTTCTGGTACTTCCTGCTCAACCTGTTCCTGGC
GCTGGTGGTGGCTGAGTCGTTGATGCACGTCATTGGTGCCGCCGTGCCGCTCTACATCATCGGCATCGCTCTGGGCGCTGGCATCTACGGCATGTTCATG
CTGTGCGAGGGCTTTATGGTGCCCAAGTCGACGATCCCGGACTACTGGATCTGGTCCAACTACCTGGCTTTCCACTCGTACTCGTTCAAGTCGCTCGTGT
TCGAGCACTTCAACCAGGTGGACACCCCGACGGCCAAGGCCATCCTGCAGCGGCTGGACATGGAGGACGTCGACACGCCGCAGAACATGCTCATCCTCGT
GTGTTTCGCCATCGGCCTGGAGATCGTCTTCACCTTCATCCTCTACAAGTTCCACACCGGACGACGGTAAG