Description :
From Genome Similarity Track
Location :
Scaffold_479:9542- 10583
Transcript NameFunction/comments
Hyaar_Emoy2814194TTK family protein kinase putative

Sequence
1041 bases(100 bases per row)
TGTAAGAATGAATGGTTCAATAAACCGCCTTCGCCAGTGATCGGAGGTCGGCGCCGATGTTCTCGTTGCAAGCATGAGCGAATCACGTCTTCCAGGTCCT
TGTTTCGTAGCGGTGGAAACGGAATTGGTACCGCCGGGTCAATAATACAGCGGAACTTCTCAATGATATTGTGCACATCCGCAAAGGGAGGCTTTGAGTA
CACAATCTGGTAGAGAATGCACCCTAGCGACCAAATGTCACTCGCGCGCCCGACCTGCATAGCAAGTCAGGGCATCAGTACGTAGAACAAGTTTTGTTGA
CATCCATCGCATCGTCAGCCGTACCTTCATCTTTCCTTTGGGGTCGCGATCGCCGTTGGGCATTGTATTACCCTGAATAGCCTCTGGAGACATGAAATTG
ACTGTGCCAATCTGACTATCGCGCTCGATATTCGTCGTATCATTTGACGGAATCGCCTTTGCGATTCCGAAATCAATGAGTTTCAGCGCGCCATTGACAA
ACAGGAAATTTGCCGGTTTTAAATCGCCTGTAAATCAGCAGTTTTTAGCCCGTTGTTGTGTCGTATCATCAATTCTCCAATACTGACCGTGGATGATTCG
CGTTCTGTGAATAGCATCGACAGCTTGAAGCATTTGAGTCCATATCACTCTTAAAAGGTTTTCATCCATGCCGCCTTTCAAGTTGCGAAGTCGTTCGCTC
AGATCGATCTCACCATGTTCCATTATCTAAGAACGCGCGAGCACGACACACGTAAACAAAAATAAGAGAGATGCGACTCACACAAACCTACCACGTTTAT
CTGCCGCTGCTGTAGATCCTGCTCGGCAGCAATGAGCTTGATAATATGCGGATTTCCTTGTAATCGTTGCAGCAAATTAATTTCGTTCGTGTACTGGGCA
ATACTTTGCGCATCGAGCTTTTTAAGCTTAATCTTTTTCAGCGCATATATCTTCAAATCGGGGCCAAGCATCCTGTAAACTTTGCTGCTGCCCCCACTTC
CGATCTGCTCCAACTTTATATACCTCAGCCCGTTCACCTAC