Description :
From Genome Similarity Track
Location :
contig_7:95408- 96870
Transcript NameFunction/comments
g2476.t1hypothetical protein

Sequence
1462 bases(100 bases per row)
GAGGTGCGGCTATGGGGATCTCCTCCTCGTCCGATCACAGACGAGATGCACAAAAGACTGCGGATTCTGGAAGGCTCAGGTGTCTATGGACTTCAACAAC
GTCACTCATCGGGAAGGCAAAGCCAGTCGCAAAAGGCACCAGAGACTAGTCGGCGCATTCAAGTAATGCCCGACCGCAATTTCCAAGAACCGAGTTATCC
AAACCTCGCACTCCAACAAGAAAACAACGAAACTGACTTGATCTCTGAAGGGAGAGGGAAGAGGATAGTATTACAGGGCACACAACTTCTGTTTCATTGC
GAGTACCTTGCTCTGGTCGAGTACATCGAGTGCGTCATCCCTCTGATTTACATGGTGTATAAATCCGTACTTTCTCGACTTCCGAATGCAGCCTACTTTC
CTGATGCTGGCAATTGGGGCACCACTGCAGTCACCAATTTGCTGGTATTTTCAACGATAGAAGTCGGGTCGTTCATTTTCTTTAACGCGCTTGTGCAGCG
GAAGTTTGGCTTTTCTCCGCTCTACCAAGTTGCGTTTGTACTTGAAACGCAGTTTGCTCCGGTGCAGGCAAAATTATTCCTCGAAACGATATTTCTACTG
CAATACGAGCTTCAACACTTGGGTGAGAAGCTTCAATTGCTGATATCTTTGGTGACTGGTAACTAAATCGTACTACTATCCCATACTGCTTTGTAGGAGC
TGATTTCACATTCCAATTTGAGTGGCTCCGCAGTCAGGCTGCAGTCTGAAGTTGATCTCCAACGATTAGTATCAGAAAGTGGTGAAAGTCTCCACTGTCC
CACGTCACGACCCGCTCAGTACTTTTGGAGCCTGGTAAATAGTTCGTCAAGAAAACATATCTCAATGTCGCGTTGTATGACAGTTGAATGAGCAAAGAAT
CCAATCGTTTCTCTCTCTAGTAGTAAATGCTCCACGTGCGATGGTGCGGCAGGAGATCTTCTTTGTTGTCCTCTCCAATTTGCCATAGCAGCCAATCCAG
CTCAATCACCTGAAGATGATGACCTTGGTGTGCCATGTGATTGTGGATCATTTCGACCGCCTGGATGGTTGCAGCGCGGATTTCAAGTTCCATCTGCAGA
GCATGAGTTTAGCACAGTGACCATCTTTACATAAGAAATTGCGTAGAATGTAAATTGCATAAATGAAAAGGACTCACCTCGCTTCCGGCCGGAATCTCAC
CTTTACTGTCAACCAGTTTAGCGAGATCTGCTGAGTACACCATCACACCTTCCGGTCGAAGCACTTGGGGAACGCGATAGTCAGCTAATGTCAAATACAC
GTAACAGAGAAAATCATGAGAAAACAGCCTAGCATGCGTTGCCATCATCAGGCCAGTGAGTATCCTACCGAACATGGTCAGCTTGCTTATGTCGTGGAAC
GAGGCAATGCCAGAGGTTCGACGACCATAAGCAGCCCATACGTCGCCGACCAAAATCTGTGC