Description :
From Genome Similarity Track
Location :
Scaffold_222:9540- 11538
Sequence
1998 bases(100 bases per row)
CCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCT
TGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTG
AGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTC
GAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGAAGCACTTGCACTTGTGGCCCGGGCGCTCTCATA
CCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGACGAGCCTGTGGCCGTCTGGTCCACTGGCG
AGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCTCACTGGCTTCTTGTCGGATCTGGCTCGATCGTGGCCGGATTGTGTCAGATC
ACGCGTGGGGCCTACTGGATCCCGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCT
AAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGATGCAGCTTGGCTGACCCTCGGCGACGACACCG
GATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATC
CTCTGCGTCGAACGCACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGATGCTCTT
ACCGGTTCCCTTGGATCGTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACT
CGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTTTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTT
CTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTAGCTTAACCGGTGAATCTGCAAATGCATACCAATTCGCCTTCACTTTCCCTTGT
TTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCA
CCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTC
TTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCTGGTTCGAATCCGGGCACGCGCACCATTGTGGTGTTGCGGGATCA
CCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCT
CACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGGGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGG
GGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTAGTTGTTTCCGGACCCTAAGCGAATACTCGAGCTTGATGGATCCAGGGCCTAGATCGTGGAT
CTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAT