Description :
From Genome Similarity Track
Location :
Scaffold_2221:954- 3551
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_2221-abinit-gene-0.4Conserved gene of unknown function
Pytar_ATCC12531snap_masked-par_contig_2221-abinit-gene-0.6Conserved gene of unknown function

Sequence
2597 bases(100 bases per row)
CAAGAGTGCCACATCTGTCTCGAAGACCTGCGCGCAGAACTCGTAGCGTGTCCGTGCGGCCACGTGTACCACTACGAGTGCATTGTGCAGGCGCTCGAGG
TCAACAAGCAATGCCCAATCTGCCGCGGCCGCGCGACGCCGTCGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCTTTCTCGAAGTGCCCGAGC
CCAGCGCCGAACAATCGAACGCCCACTTGGTCGCGAATGCGCAGAGCAGCCACGAGCCACAGGTCGCGGCATTGAACGAGCGGCTCGCGGTGGTCATTGA
GGCGCTGCGCTGGCAGAAGAAGCAAAACGACGTGGTCGTCGAGCAGCTCAAGAGCTCGCGCCACCAGACTGAGCAGCTCTATGTGGACAAGCAGACACTT
TTGCAGCGCGTGGGCGCGCTGGAAACCAACAAGAATGAGTTGCTGAGCAAAGTGGCCAAGTACCAGATCGAGCTGAGCCGCCAGGCCGAGGCCGCGCGGC
AGTTGGCTGTGAACCAGAGCATTCTCAATTACCTCAACACGTGCGACGCGGACGCACTGGAAGACGATGTGCAGAACCCTCGAGAGCTCGTCGCGGCGCT
GAAGAAGGCATGCAAGTTTCGCCACGACCAGTATCAAAAGGTCGTCAAGGAGAAAGCAAAACTCAAGGCAATGGTCCAGACGTTGCAGCAGCAGCTTGGA
GGCGGAGGGGTCCACCACGACGTGGACGACGAGACGAGTGTGATCGGTCATATGAACCGCGCCGGCAAGCACAAGATGAAGAGCCCGGCGGAGGCGAAGC
GATCGTATTCAGCGACCGAGTACACGACCTCTCATCCGCACGAAGTGAAGAAGCGCAAGGTCACGATCTCTCCGGCGGGCGGTGCCGCCGCTTCTGCTTC
GACCTCTGCGACCGCGTCAGGTCTGCCGAGCTTTGCTCCGCGTGGAGAATCATCGACGTTTCGATCGAGTGCCTACACGGACGTGGCGGTGCGTCCGCTG
GCGGCCACCAACAATCTGCCGCGGAATGCCACAGGATTTGCGCGCAGCAACTTCAACCCGAACCAGTATGGGTCGTATAACCTCATGCCGTCCCATGAGC
CACCTGTGCAAGCCTCGGACCGAGCCGTGTGCCGTCGCGGCTACGACGAGACAGGCAAGCTGACCAACTATTTCATCCCCAAGGAGACCAAGCAGCGGTC
GTCCCACAATCACGCTCACGCCAAGAGTATGGCGAACGCCCGTCCGTATCCTGGCTCCGCGTCGTCTCACGGCACAGGCAACCGCCACCACGCCGCCTCG
GCCACTGCGCCGTCACGCCAGCAATTCCCTGGAGATCGCCGCGACTACCCTCTCACGAACTGGCTCCACAAGGGCCAGTGAGTTGAATTGTCTGTGTGGT
GCTTTGTCCAGGTACTGGAGATGACATCGAAGAAGGAGGAGTAACCGGACGGTGTATGCAGTGGCCCCCAATGCCTTCTGCCCGAAGTGTGATTGAACCT
GCCTGAAATATAAATTATTCATTCTCACTCTGCATTTGCTTGGTCGTTCTCAGTGGTTACTGGATGGAGCTTGGCGTGAAGCCCTTGCAGTGCGAGGCGC
AGACGCGTGTATTGCTCATTGACAAAAGGTTCGAACTGACTGAGGGGAAAGTGCTTGTCCGGTATCAGCAGTCGGTGGAGGTCGGTGATCGACAAGTATC
GAGTTGCTTCCGTGGTCTCTTCTTCTTGATTGTCGAGAATTGACGGTACGTCTAAAGGTCCCGTGACGGGCACGACTTCTACCGATCGGCGACGAACGCC
CCCACGCATATTCTGGTCTGGGTCAGTGCCCACAGGAGGCAGCGGTGAGAGACGCCCAACGATGGCGTACAGAAGCGTCGCCACGTTCTTGAGGTTAGTT
ATGACAACTCGTGGCGCATTGGCTGCAGTACCGATTCCGCTCTCCCACGGCCGCAGCACAACGTGCGGAATGAGTAGACGAAGCAGCATGAAGTTGGCGA
GAACAATCTCAAAGCGTGAATAGCTCTGACAAGGGAGAACCGTGCAGTCGCTTCGCATGTTGCGCGTTGCGCCAAGCGCGTCGAGATCAAGAGCTTGTCG
CTCTAGCGCGAAGAGTGGATACTAATTCACAGAAGAACAGCATCAGCGAGCAGCTATGAAACCAATGGCCACGGCCGCTCATACCATCGATGGAAAGTAA
ACCCCGTCACTGGTGAGGCGCTTCCAAAACTCGATTATCCCGCTGGGAATGTCGCCTTTTTCGATCGCTTTGACGATCGCATCGACGATGCCTTTGACTC
TCACTTTCAGCTTTACGGTTCGACTTTGATCCGCGGTGGGAGGAGTTTTGACTGAGCCCTGAGTCGTTTGTGTCGCGGACGTTGACCGATTTCTTCCAAA
CCACTTTGAGATACCCTTTGACGCTTGAAACAATCCGGGTTTCGTGCTCACGTCGATATCCAGGGCAGGGTCCTGAACGATGGACAGCAGCGGAATCTTT
GTGATCTTTCCGAGCCACACGCGAGTGGCGTCATGGTATATATTGAGCATCGGTTTAAGGTCCTACGACAGGTATATATGGAAGTGAGAGGCATTTC