Description :
From Genome Similarity Track
Location :
contig_7:95390- 96852
Sequence
1462 bases(100 bases per row)
GAAAGAGGTGCGGCTATGGGGATCTCCTCCTCGTCCGATCACAGACGAGATGCACAAAAGACTGCGGATTCTGGAAGGCTCAGGTGTCTATGGACTTCAA
CAACGTCACTCATCGGGAAGGCAAAGCCAGTCGCAAAAGGCACCAGAGACTAGTCGGCGCATTCAAGTAATGCCCGACCGCAATTTCCAAGAACCGAGTT
ATCCAAACCTCGCACTCCAACAAGAAAACAACGAAACTGACTTGATCTCTGAAGGGAGAGGGAAGAGGATAGTATTACAGGGCACACAACTTCTGTTTCA
TTGCGAGTACCTTGCTCTGGTCGAGTACATCGAGTGCGTCATCCCTCTGATTTACATGGTGTATAAATCCGTACTTTCTCGACTTCCGAATGCAGCCTAC
TTTCCTGATGCTGGCAATTGGGGCACCACTGCAGTCACCAATTTGCTGGTATTTTCAACGATAGAAGTCGGGTCGTTCATTTTCTTTAACGCGCTTGTGC
AGCGGAAGTTTGGCTTTTCTCCGCTCTACCAAGTTGCGTTTGTACTTGAAACGCAGTTTGCTCCGGTGCAGGCAAAATTATTCCTCGAAACGATATTTCT
ACTGCAATACGAGCTTCAACACTTGGGTGAGAAGCTTCAATTGCTGATATCTTTGGTGACTGGTAACTAAATCGTACTACTATCCCATACTGCTTTGTAG
GAGCTGATTTCACATTCCAATTTGAGTGGCTCCGCAGTCAGGCTGCAGTCTGAAGTTGATCTCCAACGATTAGTATCAGAAAGTGGTGAAAGTCTCCACT
GTCCCACGTCACGACCCGCTCAGTACTTTTGGAGCCTGGTAAATAGTTCGTCAAGAAAACATATCTCAATGTCGCGTTGTATGACAGTTGAATGAGCAAA
GAATCCAATCGTTTCTCTCTCTAGTAGTAAATGCTCCACGTGCGATGGTGCGGCAGGAGATCTTCTTTGTTGTCCTCTCCAATTTGCCATAGCAGCCAAT
CCAGCTCAATCACCTGAAGATGATGACCTTGGTGTGCCATGTGATTGTGGATCATTTCGACCGCCTGGATGGTTGCAGCGCGGATTTCAAGTTCCATCTG
CAGAGCATGAGTTTAGCACAGTGACCATCTTTACATAAGAAATTGCGTAGAATGTAAATTGCATAAATGAAAAGGACTCACCTCGCTTCCGGCCGGAATC
TCACCTTTACTGTCAACCAGTTTAGCGAGATCTGCTGAGTACACCATCACACCTTCCGGTCGAAGCACTTGGGGAACGCGATAGTCAGCTAATGTCAAAT
ACACGTAACAGAGAAAATCATGAGAAAACAGCCTAGCATGCGTTGCCATCATCAGGCCAGTGAGTATCCTACCGAACATGGTCAGCTTGCTTATGTCGTG
GAACGAGGCAATGCCAGAGGTTCGACGACCATAAGCAGCCCATACGTCGCCGACCAAAATCT