Description :
From Genome Similarity Track
Location :
Scaffold_429:9537- 11544
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_429-fgenesh-gene-0.8Myosin

Sequence
2007 bases(100 bases per row)
GATGCCACAAGTTTCCGCATGACGCGCTCCCGTTCTTCATCGTCCAGTTGAGTCGCCGACATCGCCGACGCCTTAAGCTCGTCCTTCAGCTGACGCACCT
CTTCCTCGGCCTGTTCCTGCTGCGCTCGCCAGAGATCCAAGCTGTGGCGACGTTCGGCTGCGCCAGGAGTGTAGGCAGCGTCGGTCAGACTNNNNNNNNN
NNNNNNNNNNNNAACCTTGGCTCTAGAAGAGCGCTGGAACTGCACAAGAGCCTCCGGTGACACCCCAATTGGTGGCTTCTGAGCACTGCCTTCGACCCGA
GCCGGGAAACTGAGACGTCGAGAACGAAGAGCTACGAATCCATCGTCGGCGGCATTCGGGTTGCCATTGTCGTGGAGGAAACGCTCTTGCGNNNNNNNNN
NNNNNNNTTTCTTCTCCGGTGTGAGAACTTTGTGGGCTGGAGACAATGGCGACACTTCTTGCTGCGGCTCGCTTTCGTCAGCNNNNNNNNNNTGCTGGAC
TGACGGCTGCTGTTGCTGCTGCACTGTCGGTTGCTGGATAATACTTCTCATGGCCTCGAGTTGTTGTTTCAGTTGCGCCAGTTCGTCCTTCAACTGCATG
TTGTCCTCCTTGAGCTTGGCGACGTTCTTGCTTTCCTGGCGCAGCTCCCACAGCTGCTTCTTCGCCACGCGCATCCGCTCCGCACACTGCAACGCGATGA
CTGCAGATCGGAAATGCTTGTATTTTTTCGCCGCACTAGCACACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATCGCTGCACGCATCT
CTCGCAGCTTCTGAACACATCGCGCGGCCACGCGTCGTCGAGACTGGCACTGGAGTCGCAGCACAGCGTGCCGGAACTGCAAGAATCTGCGACGAGCGCA
AAAAGCGCGAATCTGCTTTTGCAGGAACGTCGCCTTCATCGTCTGCCGCACCCAGTGCACAAAGTCTCTTGCGCGGCGACCGCGGTGCTGNNNNNNNNNN
GGAGCTTCAACACGAGCTTACGGATGCGCTGGTATCGATTGCGCTGCTGGTACATTCGGCAGAACTTCTGCAGCACGACGACCGACTGCTTTAACACTTG
TGAGCGATAGTTTTCGAGCTTTTCGTAGGGCTGGCGACGGAAAAACACCCGTGTCTTACCGAGACTCACACCCTCGGGGACCGNNNNNNNNNNNNNNNNN
NNNNNNNGTCCTCACCGTGAATCATCCGCGCGTACTTGCGCAGACTCTCGTCGAGACGTATTGCCACAGGCCGCTGCTGCTTTGTCGAGGACACTGACTT
CTCGCACAGCAAGATCCGCTGGTACCGGTCCAGGAATTGCTGGTGCGACATGCGAACGGGGAACCCAGCACGCGCGACTCGCACAGCTTCAAGCACACCA
CCACTTCGTAGCTGCTCGACGACACGTGCACATCCAAAGTCATCGCACACGTTGCGGTCGTTGGGCTTGATGCAGCGCACGTAGTGCGGCGTCGTCGAGC
GGATGATCTCCATGAGCTCGTTGAGCTGCATCTTGAACTGAGTACCGACACTGATGGCGGCAATGGACGACTTGNNNNNNNNNNNNCGGATCACGACGCG
GTTTGAGCTGGGCGCCTTCATTGGACTCATCACGGCACTGGCATCAGTTGCAGCAGTCAGATCTCCTGGGGTCGACACATTCTCGTCAGCTGCGACGCCA
CCGACAGCGGCGAGGCTCTGGATCAGTGGGCTCGACGAGCTCGAGAGCAATTGTGCGGCACTTTCGCAGAATGAGTCCTTGTTCTTGGCGAGGAAACCTT
CGGCCGTGTANNNNNNNNNNNNNNNNNNNCTTTGCCCGCGTAGTGCGCGACGATGAAGTGGGTCTGACGAAGAAAGCCCGCGGTCGCGTGAAAGTGCGGG
TGCGCGGCCTTCTTGTGGAACTCGCCGTAGTACTTGGCCACGAGCGCGCGGTCTGTGCCCTGCGGGAAGAGGCATTCCTGGTCCGTGAGCGAGAAAATGC
CGATCGG