Description :
From Genome Similarity Track
Location :
Scaffold_13:95364- 96809
Transcript NameFunction/comments
Phypl_g592hypothetical protein PHYSODRAFT_482921

Sequence
1445 bases(100 bases per row)
GCTTCCACCTCCTTGGacttcttgtgcttcttggacttcttggacttcttggcGGGGGCCTCCTCgacctcctccatcttgacgtcctcctcctccgcgg
TGCGCTTCTTAGacttcttgtccttcttaGATTTCTTGTCAGACGTGGACGCagccttcttgagctcttcaGAGACCTCCAGCATCACATCAGCATTCTT
ACGGGGTGCGGCACCGCTCTCGTAGAAAGCAAGGcgctcctccacctgctcaCGCATCTTGTCGCCGTACTTGGTCGTGGGCTCGTCAATGAACGAGTCA
ATGCGCGAAGCGATAGCGCACTTGTTAGCAAGGTAGCGCGAGATGCGACCCTTGTTCTTGGCAGCGGCGCGGCCAATGAAGGTCGAGTGAAACAGCAGAC
CGTACTTGGGCGTGTTGCCGCGGGTCTTGAGCGCGCGGAACAGAGCCTTCTCGGCACCCAGAATCTGCACCGTCGAGGCCGGGCACTTGGCCAGGTTGGT
CAGCGAGCCAGCGTGCGAGATGAGACGAGCTCCCACCGACTCGCCAATGAGCGAGGCAAGGTTCGGGGCCACCGTCGACATCTTGGACACTAGGTACTCG
TGCAGCTGGCGACGGTACTCGGCAAGCTTAACGAGACGCGTGGTGAAGTTGTCCACGTTGATCATGTCGATCTCCGACATGTCCATGCCCATGGAGGAGC
GGGCGGCGTGCAGGATCTGCTGggccttgtcctcgtccaggacgatcttggacagctcctcgagcgagTCCTCACTGAGCGTGTTGCGGTTCTTAATGAA
CGAAGCGCAACGCGCGTACACGTAGTTGTCGTTGACGATCTTGACCAGCTCGGGGAAGTGCCACGAGTACCACTCACGCACGCGCATGGCGAACGTGTTG
ATGTCCTTGTCCATCTGGTCGAGCAGAGCGATGGCCTGGATGATCATGTTGTCGGCGCGGTTCACGTTGAATTTGACCTTGGCACGCGAGTACGagtggc
cgaggccgagctgggcCTTGGCCAGGTTGCCGTgggccagctccttgacgaAGGTAGCGAAGTGCATGCGCACGCCACGCACGATCTCGAGCGTGGTCTC
GCTCGTGTTGCACGgggcgtggagctcgtccgAGATGGCCTGGGCCATGCCCTTGTCCTGCACGCCGAGCGCGAACTTGGCCTTCTTTCCGGCCTTGACC
TTGGGTAGGTTCATCTCCAGGAAGTTCTTGAggtcgtcgcccagcagaCCCTCCGACACGTTGTTAATGTTCTCGAGGGCGTTCTCGGCCGACGTGAAGG
GCTGGAAGGCCTTGAGCTTCACGATGCGGCCGAACGAGGAcacgtccgccgccgcagcctgCACCTCGGCGAGGAGGCTGCCGATCTCCTCattctccac
cacctcgaagaTTGCGTAGCCCGAGGCCGACTCGAACAGCACGAA