Description :
From Genome Similarity Track
Location :
scaffold_7:95353- 96824
Transcript NameFunction/comments
g8421.t1 hypothetical protein PHYSODRAFT_553399

Sequence
1471 bases(100 bases per row)
CTGCTGGCTATCGTCCTAGCCACTGCGAGAAACCCTAGAGCGTATGGGGTGGTCTCATTGAAAGAGGTGCGGCTATGGGGATCTCCTCCTCGTCCGATCA
CAGACGAGATGCACAAAAGACTGCGGATTCTGGAAGGCTCAGGTGTCTATGGACTTCAACAACGTCACTCATCGGGAAGGCAAAGCCAGTCGCAAAAGGC
ACCAGAGACTAGTCGGCGCATTCAAGTAATGCCCGACCGCAATTTCCAAGAACCGAGTTATCCAAACCTCGCACTCCAACAAGAAAACAACGAAACTGAC
TTGATCTCTGAAGGGAGAGGGAAGAGGATAGTATTACAGGGCACACAACTTCTGTTTCATTGCGAGTACCTTGCTCTGGTCGAGTACATCGAGTGCGTCA
TCCCTCTGATTTACATGGTGTATAAATCCGTACTTTCTCGACTTCCGAATGCAGCCTACTTTCCTGATGCTGGCAATTGGGGCACCACTGCAGTCACCAA
TTTGCTGGTATTTTCAACGATAGAAGTCGGGTCGTTCATTTTCTTTAACGCGCTTGTGCAGCGGAAGTTTGGCTTTTCTCCGCTCTACCAAGTTGCGTTT
GTACTTGAAACGCAGTTTGCTCCGGTGCAGGCAAAATTATTCCTCGAAACGATATTTCTACTGCAATACGAGCTTCAACACTTGGGTGAGAAGCTTCAAT
TGCTGATATCTTTGGTGACTGGTAACTAAATCGTACTACTATCCCATACTGCTTTGTAGGAGCTGATTTCACATTCCAATTTGAGTGGCTCCGCAGTCAG
GCTGCAGTCTGAAGTTGATCTCCAACGATTAGTATCAGAAAGTAGTGAAAGTCTCCACTGTCCCACGTCACGACCCGCTCAGTACTTTTGGAGCCTGGTA
AATAGTTCGTCAAGAAAACATATCTCAATGTCGCGTTGTATGACAGTTGAATGAGCAAAGAATCCAATCGTTTCTCTCTCTAGTAGTAAATGCTCCACGT
GCGATGGTGCGGCAGGAGATCTTCTTTGTTGTCCTCTCCAATTTGCCATAGCAGCCAATCCAGCTCAATCACCTGAAGATGATGACCTTGGTGTGCCATG
TGATTGTGGATCATTTCGACCGCCTGGATGGTTGCAGCGCGGATTTCAAGTTCCATCTGCAGAGCATGAGTTTAGCACAGTGAACCATCTTTACATAAGA
AATTGCGTAGAATGTAAATTGCATAAATGAAAAGGACTCACCTCGCTTCCGGCCGGAATCTCACCTTTACTGTCAACCAGTTTAGCGAGATCTGCTGAGT
ACACCATCACACCTTCCGGTCGAAGCACTTGGGGAACGCGATAGTCAGCTAATGTCAAATACACGTAACAGAGAAAATCATGAGAAAACAGCCTAGCATG
CGTTGCCATCATCAGGCCAGTGAGTATCCTACCGAACATGGTCAGCTTGCTTATGTCGTGGAACGAGGCAA