Description :
From Genome Similarity Track
Location :
contig_2:953513- 957520
Transcript NameFunction/comments
g654.t1hypothetical protein

Sequence
4007 bases(100 bases per row)
GGTCGTGTCATCAAAACGTTCAAAATTGAACCGTTTGATGGCTCCGTTGAACAAGGAGCGATTGTCTCAGGAGTGGCCACGTGGTTCACGCGCCGAAGCG
CTACTGGAAATGCAGGAAGATCTCCATCAAGTACGCCTACCAGAGCGTATGAAGAACGCCCTGATCTTTCAGCATCTAAGTGGCGCTGCCAGCCAATGGT
ACATCTCAAACCTATCGGATCTTCGCTTGCGCACATTTACCAGTCTTGGGCAAGAGTTGAAGCGGGAGTTCGGCAGCAAGTTGTCCAAGGCACAGATTGG
ACAGTTAGTGGCAAACGAGAAAAAGGAGAACTCTGAAACGTATCGTACTCGTTACGCCTTCGGACCATGGCTGCAGCAACCTCATCAGATGGTTTCGAGA
CAAAGGACTCAAACAATTTAGCGCTCAGTTCTTTCATTGTGAACGCTTGGCGCAAGCACACTGACAACTTGCGCATGGTCATGAGAGAGGACTCGAGTCA
CCCCGTGCGTGAATTTGATCGAGTTATCTCGCGACTGTGCACAATCGCTGGTCATCAAGGCGTTCTATCTTTCCCGTCGCGACAGTCTGCACCAGCCACA
AAATTACAGCCATCCAACACTAGCGCTAACGCAAAATCGAACCTGGGGAAGAGAAGGGTGGCAGAAGGAGAAATCAAAAGGGAAGGTGCTTTCAAGAAAC
GAGATTACTCAAAGATGCGCTGCGGCACCTGAGGAGAACTCGGTCATACGACAGGTTTTCATGACAGGTATGTGGCGCGTCAGTCGAGTGGTATGGCTTA
CCTTGCCAGTGACAGCATTGACATCAAGTCAAGTGATCGTGGTGACGTGCAAGGTGACAAGGGCGGCGAGCCAAGCTCTTTTGACTGATGGTCGAGGGAG
CCATCGGACCCCAAGGTTCACGTATTTGACCCTGGGATTTCCGATGGTGCCCCGATCATAGATTCCGGCTCCACCTACCACGTGACTGGAACACGCAACA
AGCTTTTTGATCTTCGAAAATGCGAGCCACATGCTGTTGAAATTGCTGATGGAGCGTTAGTGTGTGGCAACCAAAAGGGGAGGATGCTCATCAACAAATT
CACGGACAAGGAGTGTCTATTTATGACAAACCACTTATGCGAGGATCTGTTCAGCGAGGTGTATACACTTTGGACATTCCGCCAGGCATGGCAGCCTGTG
CATTGCGTCCGAACTCAATCGAGGACTGGAATCAAAGGCTCGGACACTTGAACTACCGCTCTGTCGCTGAATTGTCAAAGTCTGATGCTGTAAAAGGGCT
CAAAATCGTGGGCTCTCTTCAACCCTCAAAGCCTTGTGAAGTGTGCGCGCAAGCAAAAATATCTCGTGCACCCGCTCCACACCAAGCCTCAAGACCACTC
GATGCTCAAGATGAAGTCTGCCATGGAGATCTGGCAGGCCCCTTCACAGCAAGCTATCATGGCAACAGGTATTATTACGCGCTAAAGTGGAAGGGACACA
CAACCGTGTACTTCATCAAGACCAAGAGTGAGGCTGCAGTCTGTTTTCAGCACTACATGAACATCGTTAATCGACGTTTCAACAGATTGGACGGAATCAA
AGTATACAGATCCGATAATGGTGGTGAATTTACAGCTGGAGACTTCCGAATGGTTTGCGGGGGTGATGGAATAGCGATGGAAATGTCTGAACCTGATGTT
CATCACCAAAATGGCGTCATCGAGCGAACACATCGAACCATTGCTGATCAGCTCGTGCACTAATGTTACAAGCTCAACTCCCACATTACTTGTGGGAATA
TGCCATTCGAAGTGCCGTGTATTCCCGAAATCGAGTTCTTTCTCGCTCCGACCCAACCTAGACGCCCTTTGAAAAGTTTTGGGGAGAAGACCCGACTTAA
AGTTGATCAAAACGTTTGGCCAGCGCTGCGTTGTACTTATACCTCCGGAGAAGCGATCAACGGCTTATAAGTTTCGACCTAAAGGCAGGACGGGCGTCTT
CATCGGGAGTGACCCTCAAAGAAAGGGATACTTTGTGTACGTTACGGGACACGGTAATCAAGTGATACACAGTCGAAGTGTGATTTTTCTGGAACCACCA
AAAGCCAATTTACCAGCGGAGTATTCTGACCCAAAAGATGACCCGTTGCTAGTTGTTCCTGATAACTGCGAGATCCAATCGGAATACGAGGACATCAATA
ATGTAACTGATGAACCTAGATCCCCAAGACGTGAATTACGAGTTGCTGGCAACACAATGCGTGACTCCGTGGGACCTGGCTTGACCCCACACCAAGTGGC
AGCTCTTAATGGTTTTGAGATACCTACACATCTTCGGCGATCAGAACGTATTGCAAACAGATCACTCGGTCTCGTACTCAGCGCTGCTCATGTTACACTT
CGTGAGGTAATTCAAGAACCCCTGAATTTAAAAGAAGCAAAGGCCTCCACTGAGTGGCACCTTTGGGAACAGGCCATCCAGGACGAAATCAAAGCTCTTA
GGGCAAACGATACTTTTGATATCGTCGAACCGCCAGTTGGAGCTCACATAATTGGGTCAACGATCGTATTCCGAGTTAAGTTGGGCGAAAGTGGGGAAGT
CGAGCGATTGAAAGCACGAATCTGCGCTCAAGGCTTCACCCAAGAGTTCCTAAAAGATTATTTTGAAACATACACCCCGGTTGCCAAGCTGAACTCCATC
CGTGTATTTCTTGCGTTGGCTACTCAAAAAGGGATGCGCGTACGCCAAGGCGATGTTCCTACGGCGTACGTCAAGGCAGCGTTGTCCGAAGTACTTTATG
TGTCCGGCAGCCCCGCGGGTTTGAGGAAGTAAGTCGATCCCATGTGTGGCGACTCAAAAAGGCATTATACGGCCTTAAACAAGCCGGCCGGGAGTGGAAT
GTGGAGCTCAACAGTTGTCTCATCGAGTATGGATTGTGTTCAACAAGGGAGGATCCATGCGTGTACACCCATCCAACTAACGAACTAATTGTTCTTATCT
ACGTCGATGATATTCTAATAGGTTATCATGATGAGCAGGTACTAGAACATTTGATGCAAGCTCTTTATTCCAAGTACCAGATCAAAGATCTTGGAGACGT
ACGGTGGTTTCTCGCATACGCATAAACATGGATACAGCTCGTGGAATCACCACTCTCGACCAAACCCAATTCGCATCAGAAATACTGCGACGTTTCGGTA
TGGAAGATTGTCGACCCCGAAAGACCCCGTTAGATCAAGGCACGATTTTATACAAACGAACTCAACATGATGATGAAGATCAAGAAAACCCTTATTGACA
GGCTGTCGGAGCCCTTCTCTATCTCGCGCGCGTTACCAGGCCCGACATTGCATTTGCGGTGAACCAGGTTGCTGCGCATGCCTCAAGTCCAGCTCAGTCT
CACTGGATTGCCGTGAAAAATATTCTCAGGTACATTGAAGGAACCAAGAACATGGGCTTGATCTACAAGAGAAATAAGTCAACTGTCCCCGCCAGAGTGT
ACACGGACGCTGACTGGGCCAATAACGAGGAAGATCGGCGATCAATCTCTGGAGTTCTCGTTCAAGTTTTCGGTAACTCTGTGTCTTGGCAAACAAAACG
ACAACGACTTGTTTCCAAGTCCTCTACAATTGCTGAATACATTGCAGCGGATGATGAAGTAGAAGAAGCATTATGGACACGGATGCTGCTTCAAAGACTG
ATGAAAACTCAAGCTCTCGACGCAATTCCAGCGATGATTGACAACAAGTCAACCATTCAAAGACTGTTAAACGGAAAAAATTCCGAGGCACAAAAGACAG
TTGATTGTAGCATCTTCTCGATACGGGATGCTATCCAATCTGGGCATCTACAGCTCAAGTACTGTCCAACTGCAATTATGTTAGCTGATGGACTGACCAA
GGCTCTTGGATCTACACGATTTAGTGAACTGCGTGAAGCAATTGGCATCGAAGAATTGACATCCAGCGCTGGTGGGGAAGTGTTGAAGTAGCCAGCCTGA
ACTTATC