Description :
From Genome Similarity Track
Location :
Scaffold_3:9531- 12800
Transcript NameFunction/comments
Albla_Nc14004100conserved hypothetical protein

Sequence
3269 bases(100 bases per row)
GAATAAGCAAGCTGGGTCTGCTCATCCTTCATGTTGTGGTGGGAGTGATATCGCATTACGAGAGACATTTGGATCCTATATGTGGCACATCAACTGGAGA
TGGGAATTCGCAAATAGCACAGAACTCGTCAAAATGATGAAACATATTCATAAGTCTCGAATTGCAGCGGGATTTTGGGTTCTTGATTGGCACCTGCGTC
AACGAAAAGACCAGATCCCCCATGGAAAAAGTCGCCAAGCAAAGAGCTATAATATGGCAGCCGCAGACTTTGGCGGTCGATATCAAAAGTACAGAAACAA
TGCAACGAATTTCAACAATCATGATGTCAACCCGCCTATATGGTCAAAACATCGCATCCAAAGCGCTCTTTTCAATGTGGAAAGCGTGACCTTTGGACGA
GAAATACTGCTGGAGGATAAAAACGGACGTGAGCAATGTATTCTCCTGCAATATGGAATGCTTCGCGTCTCTGAAACCCGATTGATCACGTCGTTTTGGA
TGGAACCTCATCATGGCGTAATGAAACCCATTATTCAAGATGATTTCTACCGGGAGCTTCACAAAAATTTAGATCATGCGGTCGGTCACGAGCGTCCAAT
GCAAAAACACCAAGGAATATTGAGTTTGATTGTGTGCGTTCCGACTAAATCTCAAGAGGAACCTAGCAATGATTACTCCACTCAAGGATCTCACATTCAA
GAAAAAGAAGCGGATACAAAGAATATTGCAGCCAGACAGAGCCAAGCGAAAACACAATCACAAATGGATATATCAGACAAAGTATCAGCTACGTCGAGTG
TGTACGGTATAAACCCGGAGATACCGAAGCAGGAAGTGAACAGGGCAATCCACGACGCTGGCCAGTTGTATTTATGCGAAAACGACCTGCTTCAATTGGT
CACAGCATTTCTTTTTCATTGTGATCGCCAAGTAGTAGCGTCTCATCATACATTTTCGATTCTTCGTTCAGCACTCAGAGGCGTTGATGCTCTACCCCAA
CCTAATCTGAAGTATCGGAAAATTGTTGGTGGAGAAAAGAGTGCAAATCAAACAGAAGGAACGGCAGATAGTTCAAACCTTTTGATACCTCCTTTTAGTA
CAGCCAGACTTTTGAGCGTCTCCAATCGAGTGACGGATCAATTCTTGATGTATTTAGAGCACGAAAACTTGGTAGCGGAGCTCGATTCTCTTGAGGTGGA
CCATGTCAACGAAATCGTTACTCATGAGAGTGGACCAACGAAACCACCTATGTCAAGCTCAAACCTGCATCTATATACCATGCTAAAAGAGACATTGCAA
AGTCTGAGCGATTTTGAGGTTACCTGGACGGACATAAACGGCGAGCTGGTCACCAAGACATTTCGTGCAGAAGACGAGAAAGGCTTATCGGTAAATAGAT
CAGAGCGAAGTATACCATTGTGGATCACGTCGCATCTCAGTAGCTCCGCTTTTTTGGAGGAATGGATCCCGCAGTACCAACTTAGTCAAGGACGATGTTT
TGGCAAGCTCATCAACAAGCATGACATACTACTCTCTTTCCTGCCCTCATTGGAAGTCATGGAAACACGCCAAAAACCGAAATATTCGCCAGCAGATCTA
AGTGGAGGAGCTACCACTAATCGCAACGAAGGAAATTGTGCCCAATCCATTTTAAGTGCAGTGGGTGCTGAGAGAAAACGAAGTTATAAACTGCGAGATT
GGGACAACACTTACATACAAAAGACAAAGAAATCAACTTGTGGCTCATCTTCATCGGATGATATCGTATTGTACTGGCAACGACGTCAAAGCTTTCGTGA
AGACTATCAATCATGCCAAAATAATCGACATACTTGTCAGTACCACCAGCAGCCTCCAAACCTAAAAGAAACTCCGTCAACGACGAAAGACCATGAACTA
TGTCGCAATTTTAGCCGTGAATCACTTTATGGAGCTGATTCTCATCTCCTGTTACGAACTAAAGACGAAAAATTCAGCACAGGATTCTTCCAAGTTGCAT
TCTATGAAATAGCCAGAAAATCACTTTCATATGAGCCGTATCAAATTGATCGACGCAAGATTCAAGAAGCTGCAAAAGATGATGAGAATCAAGCGACTAT
ATACTCACAAATTCTACCAAATATTTTTACAATTATCGATAGACCACCCAAAGAAGACAAGAATAAAAAAAAGGATTATAAATTTCGTTCCGAACATCGA
CAAGGAAATGCACCAGCTGGGAGCGGCGATCGGAAAGATTTTTTGCAATCATCAGCAGCTCGTCAGTTTCGGGAGAAGATGAAACGAGCACACGAGCACA
ATTTCTCCCGCGGTGTTTACATTTCTCTACGGGAGGGCACGTTGGTTCAACAGAGCGATTTGATGCAAGCAATATCCAGTTGTCTTCGATTCCCCCTTGA
TATAGATATAACGGTCCTCCATCGCACTCTACAAGCTACCTCTACTCGCCCGGAACTATTTCAGTTGCAAAATACCTATCAAAAGCATCATACCACTGGC
GTTTGGGATGAACTGATGAAAAGATTTAAAGAATCATTTATTCAAATTCTCTTATCAGACCATTTGTTCAAATCGATTTGTGGGACCGAGTATTACGTGT
TTGTTGGCAATGAATCGATTTTTGAAGCTGAGAAAGTCGGGCAGGAGGACAATGTCACCCAAGACAACGATGACAACGGTTCTGATTTGTGCTCTTTGGT
CCAGACTGATGTTTTGGATACCTCGCAGCAATACAACGAAAGTATGAGCGTCTCGGAAGATGGAACGGAGGATGGAGTCGAACACGATCATCTACAGGCT
CAAATGAACGACAAAGCACACAGTAGCGAGATAGCTAGAGATGGTCAGACGGAAAACTGGAATTCTGATACTATGTTCAGGGGCGATTATTCGACACGCA
TTCAAGACGGGCGACAGAAAAAGAAGGAAGCTGTAGACCTCGAACTAAACAAAGACGTTGCGGTTGCTACATCCAACCTATCAATGCCGTTTTTTCTTCG
ATTCGAATACGTGGAAGTTGATACAACTACTTTGAAGAAAGAATCTCTGCTAGGAGAAAGCGGTCTGGACAAAAGGTATTTTCGAAATGTGGAGCGACCA
AGACCACTCTTTCATCGAAGTCATAGCACGCATTCTCTCATTCAGCCTTCTATTGAAGAGAAAAGAGCAGTTTCGAACAGCTCGAAAGCGTTAGCAGATC
AGAAGACCCTACAACACGGATCGTTGTCAGAAGTAGTCGAGTGGTTTGAAGCCACAAGCTGCAGTCGGA