Description :
From Genome Similarity Track
Location :
Scaffold_1134:9530- 11095
Transcript NameFunction/comments
Phypl_g12517hypothetical protein

Sequence
1565 bases(100 bases per row)
CACCAGAAAATTGAGTCAGCTCGCTACTGATACGGCCAAAGGTTTGTTCAGCCCGTCTGTACTTCTCCCGCTTGCTTAGCGGACCAGGTGTGGTGCGCGT
ATCGGTCTTGTATACTTTGGCAACAAATGGtgtcgccagctccgtgactTGCTCCCCAGAACTTCGGCTCTGTCCGTACCATCTGTATGGATACAACACA
TGACACATACCTGTAAGAAATCTGTACAATACCTGCATACCTGGTCTAAGCCTGAAAAAACCCTGGACATACCTGAGTGGGATGGCTGCAAACGGAATGA
CGAATGCACCACCAATCGACTTCTTGTACAGCATAGCGTGGCGACATGGAAGCTTCATCGAATTCACAGTCGCACGTCCAGTTTGCCTTCTGGATCAAAC
ACTCGTGCTGATCGTTGCGCACCGTTATCGTCTCTCCGTTGTCAGTGAATATATATCGTTCCATACTCTCATCGGCCATCGCAACCTTGTACTGGGTCTC
AATCGCCGACGCAACCCAGCCTGTTGTCATCCCCAACACGACATTCATCTCCTCCAAATACCCGGAGTCGCGTAAAGTCCCTGGCATCTCANTTTAGCTT
TGTACTTGTCCTCGATCCGACGCTGCATCGCCAAAAGTGCCGCGAGTATGTCGTGCATTGTGAAATGGGACTTAATCTTCTGCTTCACTTTCCCTAAAAA
AAACTCTCGACACGATTGTTCGTGTGATTGTTGAAGTGGGGAACGATCGCAACGACACGCCATCACCCACATTTCAGTGCACGACTCCCAGTTCGTCGCG
AAAAAGTCCCAAAGAGTGTCGTTCCCATCTCGACACGCCAAGCTCTTGAACTCGTCTCGATTCAGCTTGTAACTAGCGTCCGTCCTCGCATATATCATGT
TAGTTATGACATGTTTCAGCTGAGTCGCTACATCGACCGAGTACGACCCATACTTCCCGTTACGAACAACTTCGTGTAGCCATTTGATCACGTGAAAGTG
GCACAGGAACCCACGCGCCTCCGGCAACTTTCGCTTGATTACATCCACTTCTCGCATGTCCTTATCGACGATAACGATGCGAACAAACCGCCATTGTTCG
TTGGCTCGCTTAAAGTGGTCCAGACACTTCGCCATGTGCCAGTCTGCAGTAGGCCCATGCCCAAACTGATCCATTGCAACAATCGACAGTAACTGGTAAT
TGTATCTGCGAAAGAAAGAAAACTGGACAATACATGGACAAACCTGGAATATACCTGGGTAATAGCCAATGCATGGACAACCCAATACGCATCAAAGAAG
ACTCACTTGCTGGTTTTATACGGACAATCCATCTGCACAACCTCTGGGAAGTTGTTGTGCATAGCGCGCATGTGTGCGGTAGTCACGGAGATGACACAAG
TGTCACATCGAGCACTTTGGTTCACGGTAGACACGTTCTTCGGATTCTCCAAGTTGAACTGGATGACTGTTTCAGCCACGGCGTCATCATCAGATAGCTG
CCTGCCTGCAAAAGCATCCAACACAAAAAGTTAGACAACGACTCACCAACATGAGTCCTCATTCA