Description :
From Genome Similarity Track
Location :
Scaffold_733:953- 7722
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_733-snap-gene-0.7Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_733-fgenesh-gene-0.040S ribosomal protein S15a
Pytar_ATCC12531maker-par_contig_733-fgenesh-gene-0.1Voltage-gated Ion Channel (VIC) Superfamily

Sequence
6769 bases(100 bases per row)
CTCTCTCCTGCAGTGCGTCTGGATAACTCGAGCTCGGTGTCGACTTCCTTCCGACCTCGTGTGATACTGAACGACGTCACGTTTGGGAAGCAGATAAACA
ATGCGCGGCGAATCGTGGTGATATCGTCATCGTGCACCATGCATTCAATGAGTTGTTGCTTGCTCATAAGATAGAGTCGCGGGCATTGTTCACGTACCCC
GTCGAGGTATTTGTCGAGCAGCTGGTGTGCAAGCTCGCATTTGGCGATACCGAGATCGAAGTCAAAGCCCCGAAAAGCTTCCTGAGCGTCACCAAGAGAG
CATACCACTTTGGGGGACGGCGTTTGGGCATCTGCACGCGACTTTGGTTGAGTTGTCGCTAGGGGAAGCGATGACTGGCCAATGCACACGAGTCGGCGCA
GCCGTTCGGTCCAGTCTTCAGCCACTTGGATAAAGTCTCCCCATGTGGATTCTTCTCGGCCGATTTTTTTCTTCTGGCGCTGAACTGGGCCCTTCCATGC
CACTTGCCCAGTGAAGAATTCTTCGACATCATGTACACGCGAGAGCCGGCATAGCTCATCCCACATGGACTGGAAATTTCGCAGTTGGCTGCAAAGCATC
AGCCTCGCATGAATTTCATCATGTAATGCGAGTGCGTCTTCGAATCCTGGATTTAATGCTTGGCCCAGTAGCTTGCCTTCGACCTCGATATCGTCCAACT
CCAAGATGGCTTGTTGTATGTTCTCAATGAGGACAAACGTACTTGTGGTCCAAAGTACCACGCGACACCCCTTCATTCGTTGTTGCAATCGCTCTGCAGC
ACTTCGCAATTTGGACTCAATCACAACAATCCCACAGAGCTCCTTGAACTCCTCAACTGCACGTGGAGCAGACACAAACGTCGCGTTCACCATTCGCAGA
GTGATCGACGAGTAGTTGACGCGCTCCATACCAAGCATACCTTGACACAGCAGCCATTTGTCGGCGGAGAAAGCGCCACATGTGGCGGCGTGGAGGATAA
CGTAGTTGTTCGATAACTGGTCCACTCGGGCCTGGAGATCCTGAACGAGCCCGTAGTCTCTTTCCACAAATCGGTCTTCATCAGAACGCGTGGCTGACAG
GGGAAGCAGACGAGTTGTGGCAAATTGTAACCTTCGCCGAAACTGCTTGAGGCGACTCAACACCAAACTTGGGTGTGTGCTGATAAGCGGCGTATCGAGC
CATTTATTTTCAAGTGCGATCCACGCACCGAACCAACTCCGCACGTCGAAAACAATCGAAACATGTTGAAGGAGCTGCTCGCTGGGCGATTTGTTGGACC
ACTTGGGAGTGGAATGTAACCCCTCTGTCGACTCGAACATGTTTTGCTCAGTGAAAAGACGATGTTCGATCTCGAATGTGCTGTACAGTCCTGCCATTTC
TTCGCTCTCCTCATCGACGGTCACCAGTCGCTCCAGTCGATCAATCAGCGACTTCTTTGTTTGAGCCAGATCCCTGGACTGGTTCTTACTCAGATTCAGC
TCGTCAAGGTGGGAAGGTAGCTGGCTGAAATCGTGCTTGATTTGGTCAAGTTGAGCAGCAGTAACTTCGTCGGCGTTGGCTCTCAACTCGAGAACGCTGC
GGCGGTATTCCCCATCTCTCTCTTGGATTCTCACGAAGCACGTGGTAAGTGTCTCGTACATCGAATCCCACTCGTTATATCTTCTCTTGACAATCTCTTG
TTCTTCTGCCGACGTGAATGAAGCCCCCATTTCTTTGAGTAGCTGCTTGAGTCTCACAAGATCCGCCCGCTTTGCATCAAACCCCTTTCGAAAAGCTTGT
GTTGGCATCAGCTCTATCATATCCTTGAGCCACTGAGTCGCATCTGGAATTGTCGTTGGGATGTTCATGATTCTCTCAATCCGATTTTCGGTGTCCGCGA
GCAAATCACACAGCAGTTGCTTGTACACCCGCGGCAGTTCCTCCATCATCAATCGGGTGTGCTGGATCACATGGCCTTCATAGTGATGCAGCAATGATGA
CTGGTCAAGGAGAAATACGCCGATCTGCGTGAAGCGCGGATGTTGTTGAACTTCGAGCAGAAGACTCCGCCACACATCTCGAGCCTCCTCGTATTGCGCA
GCACTCAGAAGATTGGGTGGGATTCCGTTGAACTGTTCGTTCCATAGTTTCGTCTTCACTTCGTTGTCCTTTGCCGCATAGATATCACCGACTAGACGGA
GTAAATCATACGTGTGAATCTACATACAAATGGTCGTAAGATGCGCACTCATATACAAAAAGAACAACGGCCATCGATACATACCTCGAGTTGCTTGTAG
TACGTCTCAATACCGTATCTCATCTGCTTCAGGCGCTTGGTGTGATCTTGCAAGACTTGCGTGGATGGTTTCAAAACGGTTGCCATGAACTTGTCACGAT
CCTGAGGCGAATATGGCGCCAGTACCCAATGAAACTTCCTATTGGAGAGCTGAACATCGCATATCAATATATCGTGACCACATAAATATTAACACAGCGA
AAACGCACCAAGCACGTACCAGTTGCGGGACGTCATCCAAGACTGTCACATAGCCGTTCAAGAACTGATAGACTAGATCGAACACTTCAGACTGGGTAGG
CGAGACGCTCACTTGGATGTCCGAGAAATTCGAGACCAGGTTCACGTTGTCAATGATCCGAGCAAAGACAAACGGGGTTGGGATCGCTCGATGACGGAGA
CTGAAATGAGTCCGATAGGGCACGGTTGGTCCACCTGAAACTGTTGGCAGCGGAGTCGAGATGGTCGAACTTACACGGCTGGACTCGGCGCCTTGATGGG
TCTGATGTGGTTGCCAATGTGAAGCCTCATGACTTGGTTCATCCCCACAAATCTGTGCGTGAAGATCCATGACAAACTTGCTCATGTGTGCGGAGCGCGC
TTCGAAAAGGTGTAAGTCGACTAACCGCAGAAACACGTACAATCGATCGAGCAGTCGAGACGATCGTGTGACACACGCGTAGTTCTGCATTTCCGCTTCC
CGTTCGGCATCACACTGACGCTGTAGCAGCAGAATTTCGCGCTCGATAAGTTGACACATTTTGTCGTGCTGTAGCGTGACTTCCCGGCGAATGGACTTCA
GTCGTGAGCGATTATGCTAAGAAAGTGCGGGTAACTGGTCAACAACCCAATACGATTTTAGCAGTCTAGATTCTTCATTACCTGTTGGATGTGATCCATC
AAATAAGTAGCTCCGTGCGCCAAGTGATATGAGGCCGCTAGCAGCTCAATCTATGCACGCAAAATGTGATCAGCGTAGGTAACGAAGCCAAGTTCAGTTA
CTAGTATGATGCACGATACCTTCACACAACACTCACGGATAGCTACGAGCAGACGCGCAGCAACTACGTCGCACTGAAACAGGCTGCATGCTATTCGATC
GCGTACTCGACGATGCTTAATCTGAATCGCTTTTCTCTTCCATGACATGAAGAAAAGAAGCCCCTGGAGTTTCTGCAAGCCCCGCATTGCTGTCATGTGA
TCGAACGCACGCTTCTCCGTGACCCAGCTGTCCACATCGACAAAGTCGATGACGCTCGAACCACGGTAATGGGTGATACCGTGGTGACTCAAGGCAAAGT
ACTCGAACTCGACGTCAATAGCGCGGTCCTCTGAGATGAACTCGAGCCAGTACACGTTTCGAAAGCTGCACGGGGGATGCCTGTGGTATGCTAAGAAGAG
GACGTCCTCTTCCGGCAGGGCAAGACGCTGCGCTGCGTCAGACAGCCGCTCTGAACAGACACCAATCACGGGCTTTAGATCACACTGCTCCTCACGTCTC
ACAAAGACACTGATATGCACCTGGGAGACGAGGAATTTCGGCTCTTGTGACGCTCTTGCCGTTGTGAATGACGTCGATCAGATAATGGAGCATTGGATCA
TTGATCGCGTATTCTACAGCAACACGACAGTGAGACGAATGGATCTCTAACTTATCGACCAAGTATCACGAACTCACTCTTGTCAAACTCGTCGACTGAG
ATGGGCAAATTCAACCTGCCATCATGGCGCTGGCGTCGTCGAACTGCTCGGTCTTCTGTTGTCCCAAACAATCCATCCACTGACGCCGAGGTGGCAAGAT
CCCTCGCCTCTTCTTCCTCGCGGATACGAACCGGTCCCTCAACTGAGGGCCGCGCCTTCTTCGTCGGGTCACGGCTCACGAGGCGGCTGAGCAGCGCACT
CTGCTGCCCATTAACTTGCGCTGCGACCGTAAGCCGTGCTATCACGTCCTCACCCATACCACTCGCACTCTGCCTCCCCCTCGCTCGGCCTCGCTTCTCT
CTGTCCACTTCTTCTCGCTGTTGGCCGTCAAGCACCGTGGTGACCGCCGGCGCAGCTGCGCTCTTCGCTCCATCACCTCGTCTCATACTGTGGGCCCAAT
ACGCGGTCGTCTCGATGGCGTCACGCCGCCGCGCGTCCGGGCATCTCGGTCGCTTTCCCCCTTCTTCTCCTTTTGCCGCTTGAAGCGGCTTCTTGCCCGC
AGAAACCTTTGACGACCATCACTCTGGATGGTTCAAAAATCACTTCGAGCAACATTGGAGCAACATGATAAACCGGTTTGTGAAAAGTGCAGATTGATTG
GCTAACTGGAAAAACCGGTATGTGGCGGCCCCGCCACCAGTCACTCTTTAGTGGTCTGAGTGGTGAGCTCCTNNNNNNNNNNGAAACCGGTTTGTGAAAA
ATGCAGTTTGATTGGCTAGATGGAAAAACCGGTATGTGGCGCCCCGCCACCAGTCACTCTTTGGTGGTCTGAGTGGTGAGCTCCTCGGTGGAAATGCCGG
TGTCCGATCATTCGTGAATCCCCAGAGCCTTCCGTTCCTTACGATCCCCCAAGTCAGCCACGTAAGCAGCTCTTCCTCTCTGCGCGCGTCGACGTCCTTC
CAGTATCAGCCACGTCGCGGTCGCTCAGGCGCGCGCGCTCGCATGCTGCCCCAAGCATCCGAGCCACGCGGCTAGGGCCGTGACGTGGCTGTGGAGGCAG
CCGCCGTCCCCTTTCGCCGGTCTCGCTCTCATTCTCTCTCGCCTCTCTTCCTCACTGTGTCGCATTGCGGTGGTGGGCTATTCGCGCGGTTGTAGTTCCT
TTTCTAAAGGAACTCCTGCGTGGTCGTCTGCTGCTGCAGGGTGAGGGAGGAACGCAGAAGAGATGAGGGCGATTGGACCGATCTCGATAGGGGGGCGAGT
TGACCTTGGCAACCGAATGGGAGAACTAACGAGCCACTCTCTTTTCCTCTCGACAGAATGGTGCGAATGAGCGTGCTTGCCGATTGCCTTAAGAACATGT
ACAACGCCGAGAAGCGCGGAAAGCGTCAGGTGTTGATCCGCCCGTCGTCCAAGGTCATTGTCAAGTTCCTCCAGGTCATGCAGAAGAACGGTGCGTTGCT
CCCACTCCTCAAGCGTTCGGGTCTCGCTGTATGATGGCTGACTGGTGCTCTTCTATAGGCTACATTGGCGAGTTCGAGATCGTGGACGACCACCGCGGTG
GCAAGATCGTCGTGGAGCTCAAGGGCCGCATCAACAAGTGCGGTGTCATCTCGCCGCGCTTCGACATCAAGCTCACGGAGATTGAGAAGTGGATCAACAA
CCTCTTGCCGTCGCGCCAGTTCGGCCACATCGTGCTCAGCACGACGTTCGGCATCATGGACCACCACGAGGCCCGTCGCAAGCACACGGGCGGCAAGGTC
ATTGGCTTCTTCTACTAAGCGTCGTTGTCCTCATGCGCTCTTGGAACCCACGATAACAAGGAACACGGATTATGGTGTTTCACTCTCTCTATATCTTCTC
TATCTCTCTCTCTATCTGCTCAGAACCATTTAACCCGTTGCTCACAACGGCGAGCAGTTCCTCCGGACGAAGCCATCGTCTCAGGCCGCGCTGAGCGGTT
TTCGGCTATTAATGACCGTACACGACGCGCTATTTTTCGCCGCCTGAACGTCCGTCGTCCCTTCAAGCCAAACGACCGCGCATAGAACCGTTGGGGAGAA
CGCCGCTGTTCTCTAGTACCTCCATCTCTCTCCCCCTTCCCCGGTTCGTTCAAGGCGACGGGGTGGTCACGCTCGACCTCCCAAACGCCCCAGCACATGC
GCAATAGTGGCCATGCCGGCCAAAAACGAGATCGTGCCCCTGGACGCCGGCCCGACGCGGCAGACCCTCGCCGCCCCAGCGCCCGTCGTGTCGGCACCCG
CGAAGCCGTCGTCGAAATCCGACTTGAACTCTGACGCGCTCAACGCACAGGAGCGGCGGATACGGCTCGTCGCGGCGCAGAGGCGCCACACGGCGTTCCA
GCTCTTCTTTGCGCTCTTCGGCGTCGCGCTCATGGTCGTGCAGATGGAGTACCTGTGGTATGCCAACACGCAAGACTTTGCGGGCGTCTGTGCCATCGAC
CCGGCCACGCACTGCCCCGCGTGCCTCGCGTCGCTGCCGCACGCCGTACCTGTACCGGGCGGCCGCATGATGCTCCACGCCGTGCGCGTGCTCATTTCGT
TTTCCACACTCATCCAGCTCTACTACATCCACGCCTTCTACGCGGCCGAGTGCGATGTGCTCAAGATCAAGAACATTGTGCCGCCCAAGGCCACACTGCT
CTCGTCGCCGCTGCGCAACCAGCTCGTGCTCGAGCTGCTGGTCTTTGCCGTGCACCCGTTCCCGGGGCTCGAGGCCATCGACCCGCAGTGGCCCAACCTC
GTCGTGGCCTCGAGCCTGCTCATGTTTCCGCGCTTCTTCCTGCTCTTTCGCATGCTTCAGTTCCGCGAC