Description :
From Genome Similarity Track
Location :
scaffold_714:953- 2469
Transcript NameFunction/comments
Pl_102810hypothetical protein PHYSODRAFT_531827

Sequence
1516 bases(100 bases per row)
CACTTACTCGATGATGGTGATTCGCCCCTCGTGCTCGGGATATTCCAGTAGCCGCTTTTTCATCATGAAATCGGCGACAATCTCGGGGATCTTAGCAGCC
TCGCGCAAGATCTCGCCCTTCAGCCACGACGAGCAACCATCACCGCCGCCAGCGACGAACTTTGACGTGGCTACAAGGAGCTCTGTCTCCAAGTCCACCG
GCTCCCCATTATCGTACAGCATCTTAATGACGGCTGGTGGGTTGGCCTGCATGTCGATGGTCAGCTTCAGACCCGACACATGAGGGTGTGAACCGCTCTG
TTGTGGATATTTGTACAGATGCTGGATGAGTGCGTCGCGAACGTAAGAGGCTTTAATGCGGACTAGAACAGCGGGTCGGGGAAACGGCATCTCGTGCTTC
AAAATTCCCACTGTTATGGTGGACTTTGCGGGATATTCCTTATCACCACGGATAAAGCCACCGTTGATAAAGCCCACATCAGCAGCCAGTTCATTTCGCA
GCGCGTCAGCTACCAGATTACCTCCATTGCATTCTCCTGCTCGCAAAAGCGCCGTCCGAGTAGATAGCGTCGTCGCCAAGGTAGCCAGCACACGCTCATT
TTTCTCTGGATCATCCTCACTCGCCATTTGCTGCATATATTTGTAAAGAATTTGCTGACACGCAGGTTGCGGCGGCAAGTACGCATTTGCAATCATACTC
CACTGGGGCAAGATGATTAGTCCACGTTCGGGATGGTCCGCTGACCGCTTCAGCTCAAACTCGAGCTTGGCTAGCCAAAAGGCATTTTGACCAGACTTGT
GGATGAATGTCTTGCCTTCATACATTGTAAACGGTTCATGATCATGTCCTCCAAGCATCAAATCAATACCAGGTACTTGACGTGCAAGTTTCTTGTCCTG
TGAAATCGACAGGTGAGTCAGTGCCAAGACGAAATCAGCCCCTTGAGCTCTCAGGTGGTCTACGCATCGCCGAGACGTAGAAAACACATCGTCGAATTTG
ACGCTGGATCCCGGAAATGACAGTGTCGGTGTCTCCTCCGTGCAGACTCCAAAAACTCCAAGCTTCAGTCCATCTTTCAACGTGATAATTTCTGTATCCA
CAACTCGATCGAATAGAGCACCGGACGCAGCATCCAGAACATTGGATCCAAACCATTTCGCCGTCGATTCTCGCATGCGTGTCTTGAGTTCGTCAGCACC
AAAGTCGAATTCGTGGTTTCCCAGCACCACGTATTCAATCCCCAGGTGGTTCATTAGTTCGATCATGTGTGCACTGCAATACACAGCAAAATAATATAGA
TTAGTCCAATTGCAGTCAACACAGTCGCCACTTAACCCCAACGCACCCTTTGAAGCGTTCTCCGATTTCCGAGCCGGATAGAAAGTCTCCGTTAAGCGTA
ACCAGCAGTGTCACATCGTCAGGGAGTGAGGCTTTTTGTCGCTCCAACAGCGTTGCAAACTCGGCAATACCCCCGTGTCCGTGCTCATTGGGAACCATGT
CGTACACGTCGTTCAC