Description :
From Genome Similarity Track
Location :
Scaffold_961:953- 2254
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_961-abinit-gene-0.16Poly(A)-specific ribonuclease

Sequence
1301 bases(100 bases per row)
CGACGGCATTAGCTACTTGTCGCACGCGGACCAGAAGCAGTTCGGCGGCTTACTCGCCAAGTCTGCACAACCCGAAGTACTGCGCAAGTTCGACCCGAAG
GTGCCGGCGATCATCACGGCCGACACGCGTGAGTTCCTACAGGACATGACCAAGAAGATCAAGAAGCGCTTCGCATCGCACAAGTTCAGCAGCAAGAAGC
ACGGACGGCGCGACGCCAAGAACCGTCACAGAGGAAGCAACACTAACAGCAACGCCAGCAGCAAAGGCGGCGCGCATGATGAGGAAGACATGTGTGGTGG
TGGTGAAGAAGACGACGATGGCGAAATCGAGACTGATGATGGTGATGATGGTGGCAGTGGCAGTGGTAGTGGGAAGCCGAGCACCACGACGGGCAGCGCG
ACAACACCCTCTTCGCCAGCAGAGCTGCGAGCGGCCAAGAGGTTCCTCGACACTGGCTTGGAGCACGATCACAAGGGCAAACTGCGCTCGGACTGGCCTA
GCGCGGTGTTTCTCAGCGAGCCGCTGGCACCGTTCCGCCGCCACGTGCTCGTGCAACATCTGGAAAAGAGCTTCCCGAACGTCACGGTGTTTGACTGCAA
AGCGGACAATTGCGGGGAGGACGTGCAGCAAAACCCGTGGAAGCGCCGCGTGCGTTTGGTTGCAACTAACTCGGCAAAGGAGAAACAGTGTCTGCTGGAC
GCCTACGAGCAGATCTCGCAGCAAGAGGTGTGCGCCAAAGCAAGGGCCAAGGAAGAAGAGTGCAACTATGGTGAACTTGTGACACTGAACCAAATCTGTA
TGTGTTTGGTATGTTGTCCATGCTTATAGCTTCGAGAGCGCAACCTTGAGTTGGTCGGATTCACGGAGCTGATGGATCTGCTTGTGAGCTCGCGGAAGCC
GCTGGTCGGACACAACCTGCTGCTCGATCTCATGCAGTGCTTTGAGAAGTTTCATCAGCCGCTGCCGTCGCGCTGCTCCGAGTTTCTGCACGAGATGAAT
GCGTGGATCGGCGGTAGCAGTGACGGCAACGTTGAGAGTGAACATGGCACTAACGATCTCAGCCATTCTCTTCATAGAGGAGGCATATACGACACCAAGG
AGATGGTCACGCACGCGATGGAGAACCTCGACATGTTTGCCAACAACCTGCAGCACAGTGCGTTGGAGACGGTCTTTGAAGCACTCTCCAAGACGCCATT
CCACGGCGCCGAGATTCGCATCAAGAGTCCCTCAGAGCGGTCGTCGAGCAACAGCGCATCGAGAATGTCTTCTGCATCGTCCCTGTCCCCGCCGCAAAAG
C