Description :
From Genome Similarity Track
Location :
Scaffold_321:9529- 11828
Transcript NameFunction/comments
Phyci_74424Hypothetical protein
Phyci_257158Hypothetical protein
Phyci_202389Hypothetical protein

Sequence
2299 bases(100 bases per row)
GTGTTTTGATGGTGTACTGGTGCAGGATCTACAACTCTTCCGATGGCAAGGCGCTTCCGATAGTCTCCGATGAGAACGTTCAGGCTTCCTTCGCGATGCA
GCTGCCGAAGCGCTTTCAACACAGCGCAGGATCCTGATGAGGGTACGTTTCGCAACCGCAAGAACGCCATGACCTTGCCTGATGCTAACTCCCCAAGCCG
ACGAACATCGTCCTTGTAGCTGGGTGATGATTCGTCGAGCACGTATCCATCTTCGATAAAGAGCTTCAAGAAGGCCACAAGCTGCTTGGCGTCAGATTTT
TGTGCTTGTCGTTGCATCTCCAGCCGCGCGGTTCTCCTGCATACCACGCAAACCAGGTGTCGGTTAGCGGTTGCAGCTTCGAACGGCGTCTGCGCTTCTG
GGGTACGTTTGTTTCTTCTTCTCGCAGTCGCTTTGATCCTTGCTCACCTCGTCGTGCGATTATATCGTCTTTTTTACTGTCGTTTGCAGATTCTAACGAG
TTTACGCGTGCTTCCAGTTGTCGATTTAGCTCGATTAATCGTTCAATCAAGGCCGTTTGATGATTGAATGCAGCTTTCGCTCCTTTACTTCCTTCGATCA
TGTCTTCAGTGACTCCGTTTGCTTGGTTTGATGATCTTGCGAGCTGTTGTGACCAAGTGAGCAGGTTGGTCGTCGTCACTCCGGATTCCTTGGCGCAGGC
TCAATCTTCGCGACTACTTTACCACGTGGGTTAATCTTTAACAGCGACGGATAGTGAAGGATCAGCGTCGCAGTCAGCACTTCTCGCACAGCAGCGCTGA
TGTTGAAGGCCGGATTTCCCAGTGAGTGGCTTGCACTGAATATTTTATGgctgacttcatggatctgatcttgcgtagtcgagtcgaaggcttccagcga
cggcagtacagaggtttgctttggtgccataccactgagcaccttcgcaacttggtgatcctccttcggtgtattaaagacgtatgcaaataccttgttt
gtcgtagtcatgttccaggctccgcggtcgaagatccactgcgctgtcaagtccgagcaagcgtttgcatgctgagctcctcctcgacgaaaggagttcg
agctcagcggttctttcactccagctggacccgcaactcgatcgaggagacgattaacttgagcgtggatCCCAAGAGGTGATGGTGCCCTGGATGAATT
CGACTGAGCTGGTGCACTTGAAGGAGTTTGGTCGTCGCAGCCCTCAAGCATCCCCAGGAGGGGGACAGAGGCAGTCAGCTCAACTGGCACGTGGGCCGTT
AGCGCTGGAAGATGGCTCAACAGCGCAGTCGATGGAGCTTCCTGAGATGCCAGCGCAAGCGCAAGAGCCAgcaacggacacgaccggaagtcagcgtcgg
ggaaaagcgacagcgcttgctcatcagacgtcttcatccgaatgaagcggatgaagaaaaccccttcagcacccatggagagctgctgtttgcggacgaa
ggtcaagtccgaagcgcggccaaacaggtaccagagcaagcatagcaacgcagcatcttggtagtcctctgcgcagctagctgttgaatacaggtatccc
accatcttttgcaagtcggtcttggtgcatgccaccgccttcttcacgaaaccaccgctttcgcgcttaatacagtgctgctccagagtgcgacccatac
ttagcagctgccttgcaacagcaccacctgggacgggatattcatcgagcagccagcacttcacctgtcggtagtactgtgccacggagtgccgtgacag
atactgccccttcgaaccagcgtgaaaagcaagataaacgccaaacttgtccattatcgtcaggatgatggcgcttgcgcggctcggttcggcaaagatc
atggcgccaacttgctcgaggctggtcccttcgctcgagaggaagcgctcgaacgcctttagagcggtcgaacgcgcgcgtttggtgttggctggcttga
gatcgttgcggctcatcgtaatgggtcggagagggaggtgatatctaaatgatatgtggctgggcggccttctctatacaaatatacatatctgaggctt
gcttccgacccgatacgtcggagttaagggggttccgacctctgtctgatactgagcttttattggtaaaaaatacgagctgtgtctcgagtggattggt
ggaaacagaatcaatgcaaatcattggtcaatattcacgaaaacacgccatacaaaagatcagtgcggtcggagagatgatgttattcattcataCCAT