Description :
From Genome Similarity Track
Location :
Scaffold_22:9525- 11752
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06380FYVE-type zinc finger-containing protein

Sequence
2227 bases(100 bases per row)
GACAGAGACGCCTCGGCGGCGTGTCGCGGCCGCCGCTGTCTTTGTCTCGGCGCCGCTTGTCGCCTCCCTTCTCGACGCTGGACTCTTGCCGGCCCACGTC
GCGCCGGCGGCAAAGGTCCTTGTGGTACGCATAGAGAAGCAGTTCGTCGTCATCAATATTCGACCTTGCACTTGGCCGTTGGCGTGTAGATCGAGAAGGC
GAACTGCACGACATGTCGCAGCGTGGACGTATCGTGCGTTACTCACGTCTGTTCTGCTGGTTCCGTCGCAAGACGGTTGCGCTGCTTCGCATCTCGTGCA
CGAAGTCGATCTGCAACGTCATGGGCAAAGCGAGCGGTCGCGCTGCCTCTCTGCGTGGCGTTTGCTGTTCGAGTGTCGATCACCGAAGCGATGTCCCATA
CCACGACGTAATCTGCCTCGCCCCTCTTACTGGGCGCCTCCACCAAGCGGCAGGCGTGGGTGTTGCTCCGTACATACTGCATCGAGAGAAGACACCGCAG
GTGTAATTAGATACCGGTGTGTATATTCCACCGTGCAACGCGACATCAACGCGAGACGAGAAAGGTGTCGAGGTCGTCGACAACGGACGCGTCTTCGTCA
TCGGCCTCGAATGGTGTCTCGTGGGCCGCAAAGGTCGCCGGGTCAAAGAGCACGATGCGCGGTGGCGGCGCCGTGAGCACCGGCAGCGACTTGGTCTTGC
GCAAGTCGGCGCCGTACAAGTTGACGTACGAAATGTCCATCGTCGGCGGGTCGCTGAGTTGCCGGCTCTTGTTCGCCCATGGCGTCGGCGTGATGTCAAG
CGCGTCAAAGTCCGAGCCGCCGCCGAGCGACGATGTCCGGAACGACGCGCGCCGGCTGCTGGTCTCGGACGAGGCGTCCGAGTTGGGTGTCGCGAGGTAA
TAGCACTCGGAGATGCTGTTCTCGCGCACCTTGCGGGAGCAGAGGTTGCACACCCGTACGAGTTTATGCTCGTTGCCCTTGGTGGGCACGCGCCACTTGC
GGCTACAGCGCACGCACACGGCCTACGAACCCTCTCGTGAGATACAAAGAGCACAGGTACTCTTCGAAGTACCTCGCCGCACGATTGGCAGTTGCGCATG
CGCGAGAAGCGGCGGGGCTGCTCGCAGAGATAACAACACCGCGCCGAAGTGTCGTCGTCGTCGTCGTCGTCGATGTCGTCGTCGTCGTCACCGGCGTTGT
TGCGTTTGTAAAAGCTCTTGGTCTTTGGCAAGAGGTTGCGCGTACTTAGCCGAACCTTGTGCACATACTCGTTGACGTGCGCAAGGTGGCGCGCCCGGCG
CTTCATGCCCATCTTGCGCACCCAGTGCGGAATCGCGCCCTTGAAATCGGACGCAATGTGGTAGATGACGTCGAGCACGCCGGGAATGTCTGTCTCAATG
TACGCGCAGCCCGTGTGGTGGAGGCCGCCGCGCACCAAGTGCAGCGGGGAGTTTTGGAGGTTCACGACGCCCGGCACGTCGACCGAGAGCTGGCAGAACG
CCCACCCGCGGCGACCAGATGAAAAGTGAAATTCATCTTGTGCCTACGTCAAAAGATGTGAAAACGTTGACAAATAGCGAGAAAAAGGGCAATAATACCT
CAAGAAAGCAAAAGTCGCGGTTCTTGACGATCGGTACCGGGCTCTCAACGACCGACCACTTGATGTACATTTGTTTGAGCGGCTTGGCCGGCGTCCGGTC
AAAAAAGCTGTAGAGCGGAAACATATCGGCGAGGTCTTGCGCGTGGTGGTTGCGGTAAAAGTCGCACTTGGCACGCGTCTCGAACGCGTGCAGTTCCGCA
ATCTCCTCGAGCGTTGCCGTGATCTTGCCGACGGCGCGGTACGGCACCACGTCTACGCAGAGCGTTGAATACTTGAATACGTACAAGAAAGGCGTACTTT
TGTCGAGCTTGAAGCCGGGAATGTCGCCTTCGAGGAGCTGGATGCCGTCGTAATCGCCGACAAAGTTCCACACCATGCCGGGATCCCGCTTCAGAACCGC
ATCAAGGAATGTCTTGAACGCCTTCTCGCCGGTGGCGATGTACGCCGCCTCCTCAGTCGCCGTCAGCGGCCGAATGTCAAAGATGGACTCGGGGACGGGA
AACCCGTTGGGCACTGGCGTTGTCTTTGCGTCTGCGGTCATGGCCGCTACTTGGTAAATGCGCTTGCACCAGTTGCGGCTGGTGTTGCTGGTTTTTGAAC
CAGATGGCGACGCCGACGCGAGAACGA