Description :
From Genome Similarity Track
Location :
scaffold_436:9524- 11737
Transcript NameFunction/comments
Pl_104875ABC transporters ABCA family

Sequence
2213 bases(100 bases per row)
ATCCATTTAACCGAGCGATTCTCAAGCACAAACACGAGTGCAGACAACACAACTGCCTCAAGCAACGTGTACACCAGCGGTGCGCCAATGATCTCTAAGT
CAAACGGTTGCCGCACGCAGCACGAAGGCTCAATACGGTCCCAGCATTCCGTGCACTCTTCTTTACCCAAGCCTTCAAACAGACCAAAAAATGATGGAGA
CGTCCGAAGCCAGCGAGCAGATCCAAACAGGGCTCGACGACTAACCTTGCGTGTAGCTAGCTCGAAGATGCCGTTGTTTAGCGTGTATCCTGGGAATATC
ATGAAGACCCATCGCAAGTAGTTCCGGTCAAGTGATGAAAGAGTGAGAGAGCCCGAAATTGTGAAGTTGACGATCCGGCACATGAATGAGAAAATGCTCA
ACAAGCCACCCGTCCCCAATGCAAACACAAGCAAAGCTGTCTGGGCCACAGCGTGCTTGACGTAACGTCTTGAAAACAGGTACGCGAGTGGAATAATTGC
CCAGACATGAGCAATCACTAGGGCAATGATAGCAAAAACGTCAGCGGTGCTAGCATTTGCTGCACCAGGAGGTGTCATGGATAGCGGGATAATAACCGCA
GAGGCAGCGATCGGAATAATCGTGAGAAGAAGGTCATGCGTCCAGCTTGACATCCAATACGCCGAGACATTAGCGCCACTAATCAGCTGCAAGCTCTTGG
CATTTTGGATTGGGTCCTTTTCACGGACAACAAAAGCAACAATAGCTGCCGGTATGAAAGCGAATCCCAGCATGACAACCAGCGCGACCAAAAATCCATT
GAGGGTCACTTGGAGCTTGGCGTTGTTCTTGTCGAGACAGTTAGTGTTGTAGCACGGCGACGAACCACATGTGTTGCATGGGTACCATGGTGAAGCAACG
TTAGTTGCATCGCAACACACATCGACGTCGCAGTCAATTACACCAAGTGAGCAGTACTCGAAACCACGAAAACTAGCGCATGATGAAACATTGTAGTCCG
AATCCACAAGGCTGCTGAAGTTGGTCGACGCAGAACATTGACTTTGTTGTGCTTCTGTGGGGAGATTAGAGGCGTAGTTGGGAATGAAGTCCGCTACTTG
AATCTCTGGAAGCATGGCCAAGATAATCAGGAAGATGAGTGGAATACCCACCGAATATGCCAAGGTCTTTTTGTCACGCTTGGCAATCTGAAAGCGTTTC
TTCGTCAGCGCCAAATACTGCATCCACATGAAAGGCTCGGTGATTGGAGGAGATGTCGATGGCAAGTTCACTACGCCTCCTGCTGATACCAACTTCATAG
ATGCAGACGCTGAGGGTTTACGCTCCAATGTTGGCAATAAAACCTCTGCTTCATGCTGTTCTTCTTCGTGGTCCTGAGAAATACGCAGGAATACTTCCTC
GAGTGTGGTAACAGAAATGCCATATTGCTGCACACCAAGTTGGTGCATTTCAGCATCCAAGTGCTCCAGCATAGAAGGAAACGCCTCGGAAGAAGCGGTT
GGCAGCTGGAACACGAGCTCCGACCCGGAACTACTCAGACACTTCGCACCCGGGACGTATTTCTTGAGGAAAGCTTCTACCAACTGTGCGTCGCATGAAC
CATCAGATGCCTTAATCATGGTCAGGTTGTACCCTGCACCAAAGCGGTTCTTAAGGAAAAGCGATGATCCGGCACAACGCAATTGGCCATCAGCCAGAAT
CGCAATTCGATCACCAAGAATGTCAGCCTCATCCATAAAGTGCGTTGTCAAGACAATAACACGATCCTCGCGACTCTGCTGGAGCAAGTTCCACGTGAAA
CGTCGAGAGTACGGGTCCATGCCAGACGTAGGCTCGTCCAAAAAGACAAGCTTGCTGCCACCGAGGAAGGCAAGTGCAACACTAAGTTTCCGTTTCTGTC
CTCCAGAGAGTGTCTTTGCTAGCGCATGACGAATTTCAGTTAGCCCCACATCCTCGATCATTTTGTCTACGCTGCTCTGGACCTTGTCGCGTGGCACATG
CTTCATCATTGCAAAAAGAAGTAAATGCTCTTCCACAGTGAGGTCCTGAAAAAGCACGTCGTGCTGAGGACAGATGCCAATAACTCGGCGTAGCTCATGG
AAGTCGTGTTTGATAGAGCACCCATACAGCGTCGCATCTCCAGCAGTGGGCGGGATGAGACCAGTGAGCATGGAGATGATAGTTGTTTTACCAGCGCCGT
TGTGACCCAAAAG