Description :
From Genome Similarity Track
Location :
Scaffold_1158:9524- 11064
Sequence
1540 bases(100 bases per row)
GCATCCATGCTATCGACAGGGAGCCGGAAAAGACTCTCGTACTTTCTTTCTTAGTTTTCCACTCTCCACTAGGCCCCACAAACGTCACTCTCGGTATACA
CTCTTCAGATATACAAGGCAACACTTTTGCGCATTCTGCAGGACCATCATAAGGGAAATAAATCGAATGATTAATGCTATGCTTTCCGAATACGGCTATC
TCCAGTTTGAACGGTCGAGCAGGAGCGATGTATCTACTTGCAACATCGCCTAATTCAGGTAAATTTCCAGGGCGTCCGTAATCGTGCCCTGAGTCGATAC
TAAATTCCGATTTACGCGGATCACCCGAACACTTGCCGCACAGCGGGATTGCATTTAAATCGTGAACGAGATCGAGACTCAAACGGTACAGTCTtccccc
tcccccccccccctttgATATACCTGAAGATGTTGTTCAACAACCCAGCACGGCGTTATCCTGATGTCAGCAGCCTCGGATGCAGTCAATGCAAAGCCAC
GATGCCGCTTATTGAAGGCCACGAGTCGCACGCAGTCCTGAACAGTGTTTAGTATTttgcagcaagaagcgcacgcCCAAAGATCTCCAGAGTTCGTAGA
ATTGCGGCGAACACGACCCTGACAGAATTTTGCGTCTTTTGCGCTAAGCGGTTCATCGAGGGTGTCCAATAATCGTGTCACAGTGGCCTCGCTACCTGGC
CCTTAACCTTCTCATCGCCGAAAACACATGCATCAAGATCGGCGGAGCAGCAGTGAAAATAAAGCAGCGCGAGTCGCGGGTGCTTCATAAAGTTCCGTCG
TAGTAAGTTCAATTTATTTTTTGTCAAATCCTTAACCGACATAGTCTCTGCAACTAGTGAGTTCAATTCTCCCGTCTCATTGAGACAACTATCATCGCAA
CGTGGTTTGGCCCGCTTTGGTCCAGTCTTCCGTTAATTTACCTGTCCTTCGTGTGGCCGTTTCATAGGCTTATCCTCGATTATAACATCCTCTCGAACAT
GTTCTGTCACTATTCGACGTTTACGCCGAATGGTTTCTGTAAAACTGCGTATTGCGCCGTCATCAGCGAAACCAACAGCGACATAGTGATTACGCGCACC
AAGTGACACAATATCGGCAATACGACCCGCCTCACAGTGATAAATAACAATCGGTTCATCGTCCAAGGGCCCGTCAACCAGTGAACCAAGATCCGTCGGA
GTGATAACGAAAATTCCGTCGGCAGACGAAGTCACAATTCTACGTTTTAGCATGCATGCCATCGCTGAAATTGGAATTACTCCCGAATACTCTAAGTACT
GGTTCGGGCAAGCCACCAGGTCGCCGACATGCAGCGATTCGTGACCAAATGCATCGTGTAACTTAccttcttcgagaaggcgcgcaacttcaactccgAC
TTTGGCTCTCAACTCAAATACGTGCTCTGAAGCTGCCATCCCAAACGGTCGGTGAACACCCGCAAATTCTGCCGCCGCCCAGACGGCATAGTAGAGACAA
TTTCCACTTGTCGGTACGTCCGTCCCAAATACATCAACGG