Description :
From Genome Similarity Track
Location :
Scaffold_2:95237- 96748
Sequence
1511 bases(100 bases per row)
TCGTAGAGCAGGGCACCACAGTTGAGCTTCGACACAGTCAGCCACTCGGTCTCATCATACCCCTTCCACTTCACAAGGTACTCACGAATTCGTCTCGCTG
TCCGAGTCCGTTTAGTCCATCGCAAATCCAGGATTCGCTCAACGTCGTACTCATCGTTCGCAGCGTCGGGCTCCCAACTGTCTTCAGGCAACAGCGCCGC
ATCAAAGTCATCATCCTCGTTCACGTCGATCTCCACAGTGGGCCGCTTCGGGAATAGTGCTCTGGGTTTCAAACGGCTCACGTCTACCCAGGGATTCATG
TGTTCTCGACCCTGAGTTTCACGCGGAAGTTGTCATGGATTTCCTGAATTCTGAAGGGGCCATGCCACATGTGAGCCAGTTTGCGGCTCAGCCCGGGCGG
CACTTTGGGTATATACAGCCACACAGCATCACCGGCTGCGAATCCTGCCTTCAGTCGTTCGGACAGCTCTCTCCACTTCCTGGTTTGTTCGGCAGAGCGC
GCGCGCTTGGCCTTCTTCTAAAGATCCTCAGCGCGAGCATGTGCATAACTATAGTCACGCTGTAGCTTCCTGCGCCACTCGTACGCAGTGCGCTCCTGGA
TACTCCGAGGGCCTGGGTCCTAACATTGCAGACACCGTGCCGTGTGCGTCCCAGTCGTGCACCAGAAAAAAACGGAGTGTCCAGGCGAGTGGCATCGAAC
GATGTATTCAGGGCAAACATCAGGCGCTCAGCATGGTCGTCCCAGTCACTCTGGTCCGCCTCAGCAATGTACGCTCGAATGCTGCGCACAACAGTCTGCA
CCGACCGCTCCTGTTGTCCGTTCGCCTGGGGGCGATACGTCAGAGTGGCTCGCTGCTTGCTACCCAAAAGTTCACGGAAGCGCGTGAACACCTCACTCAT
GAACCTTGGGTCTTGGCCGTGCCTCAGCATCGAGCTCGCGCCGAATCTCCTGAAGACCTGCTCTTCGTACACTTCAGCGACATCTTGCGCCGTGGTGGAA
CTCATGGGTTCACACATGACGAATCCTGAGAACGCATCCTGAAAAGGCAGCAGGAACGTGTTCCCACGGTCCGACTTAGGTAAGTGTGTCACGAAATCCA
TAGACACAACTTCAAAAGGGCGCCTCGATTCGATGTTCCCAGGGGAAGGCCCTGGATTCTGAGGGCGCCCCTTGCCACTGGCGCAATCCACACACTCTTT
GACGAAAACTTCCACATTAGCGTACATGCCGTGCCAGTAGAACTCAGAGTGCAGCTTCTCGTACGTCCTCGTGATCCCCTGGTGCCTACCCTGAAAATCT
TCGTGAGCGTAATGCAGGATATCCGGTCGCAGAGCTTTCGGCACCACGAGTCTGAGTTCGTCAACCATGTCTCGGGGTCGATCTCTGGTGGACCGACTCA
AGCGATACAGGACTTCTCTGGAATCCAACACGAAATCATCAGCGACCTTCGCGAGTTTCCTGGCTTGAGCGTGCGACAGCTTCGTCGTGTCTCCTTTCAG
GAATTCCTTGA