Description :
From Genome Similarity Track
Location :
Scaffold_201:95219- 97848
Transcript NameFunction/comments
Phyci_98106cytochrome P450, putative

Sequence
2629 bases(100 bases per row)
GGTGGACGGCACGTTCGTCGGCAAGGGCCAAACCATCATGGTCTCATCCTACTGCAACGCGCGCAACACGGACACCTGGGGACAAGACGCGAGCGAGTTC
AAGCCGGAGCGCATGATTGATCCGGAGACGGGCAAGTTGCGCGTGCTGTCGCCCTTCGTGTTCAGCCCGTTCGGCTCGGGCCAGCACGCGTGCATGGGCC
AGAAGTTCGCCATGATGCAGATGAAGCTGACGCTGGCCACTTTGTACAGCAAGTTCGACATCAAGACGGTGGAGGACCCGTGGAAGCTCACGTACGAGTT
TTCGCTTACGATCCCGGTCAAGGGCCCTCTGGACGTGGAAGTCACGCCCCTGACCCCCCTGGTGGTGTAGAGAATCGCAAGCTTTAAAATAGGCAGCGCA
AAATGCCTTTTGTGGTGGTGAACACGGCGAGTTAACAAAATGAAGTTGGGAAATACAATACAATTGGCACTCCAGTGTTTTTTTTGTCGTTTCCCATCTA
CAGTATCAACGTCCGAGAAAATATCACCGAAAACGATAGTTTCTGAGCCATTCGCGATGTAATTAAGCATCAACGGAACAATGACGTACGAGTTCCTGGA
CGAATGGTGCGGAGCGATGCGCTTTTGCTGTTACGGACtgggcccgaagagtgtttgtcgttgaagtggttgcgagtgttggtcctgtcgagaagcgcgg
tagttgtggtcgatgtgcggggtagacggtttatttaatactgaatcgctactgctagcctaacatgcatgcctcgctgtgctcctacgcgagcacagag
ctctctttgcgtatttctggggttttccttgactatgtgctaccctgcgtgtttttgttttcttttcttttcatttcttatctactaaatgcatgttcca
agtttctttttcatgtttttcctacaaaatgcatgttcactgtgacggctgaccctctcgggtagctgccacaggaacttcaagcctctggccgcgagca
agcgagccagagcctttgcgccgcatcgctctggcttgcttgctcagcaggccagaggtacgcctgacatctccccctggttgacttcgcgttggtggag
tcgatactcatccaggagttgacgccaatgcgaaacgtgcttgatctgcgcttcgctttcccaggttgcctcattctccggcaacccatgccacttcacg
aaccattgacgtttgcgacatctagttggtttcttgagcagcttctccacaatgtagagttcttctctagtgtcctcgtccaagattagaggtacagcca
tcggaatcggtcgattcggaaaatcctcactgtttgtttggtaatgggtcagcaactccaccttgaatgtcggattaagacgtttcatcgtgcgcggaag
tatcaacttcgccacgttgtNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNN