Description :
From Genome Similarity Track
Location :
Scaffold_11:95205- 96549
Transcript NameFunction/comments
Phypa_INRA-310PPTG_07063hypothetical protein

Sequence
1344 bases(100 bases per row)
AAGTTGCGCGTCCACCGCCGCTGGAACTTCTCCTCGATTGCCTGTACGCACTTGTAATGTACTTGATGTTCATGATTGAAACTAGAGAGCGTCATCTGAC
GCTCGGAAGAGCGTGCCTCCTCCTTCTTCCACGCCGGATCCGACGGATCCAGCCTCTTGCTAATTAGTGCACTATGTCGCTGCTCCACTGTTCGCAGATA
TCCAGCAATCCACACGTCATCGACCGTCACACAGACTGGCGGAATGTCTGCAAGTGCATCCACGTCCGTGAAGAATCCGCGCCGATACGCGTTGCCACAA
CATGCCTGCAAGATATCCACATAGCGTCCATTAGGACGCATGAAGTACGGCACGTAGGCGGGCACGACGCCCACTTCGTGCCACATAGGGAGCATTCCCC
ATCCACACACGCCCAGAGCGTCGTCCGGCTTGGCGACAGCTTCCCACACCAACGACGCCACCAGTTCCGGTGGATACTCGAAATCGTCGTCCAGCGTGAT
GATCAGTGTAGACGCATTGTGCTCCAGTCGTAAAGTTCCCAGCAGTTTCGTGGCCGGACCGTCATCCACACAGCGATTCACCTTAACAAGCGGTGTGAGA
CCCACGAGTTCGGACGGGATCTCTGTCTCGTCGTATGAGCGCTCTGGATGTCGCTTCATGGGGCCTTCAGGAATATTGATGTAGATCTGGTCTGGTACAA
GGCTCTGCTTCGTGAGCGAGCGGACGCTGTCCATGACCTTGTCCAGCCGGCTAGGCGTCGTCGTAAGCGATACTACAACACGGAACGGAGGGCGCCAAGG
CGGCGATGTAGGTGGCAAGTCATCGGCTGCGCGGCCATCGTAGGCCGTGGTGAAGAGAGCTGTAGCTGCAGGAGAGATGCTGCCGTAGCGCACAAGCAGC
TGTGTGTATCCCCAACAGACGCAGATGGCGACGCCCACGAGCAGCGTACGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN