Description :
From Genome Similarity Track
Location :
Scaffold_2:95192- 99206
Sequence
4014 bases(100 bases per row)
TGCATGGCCTGGAAACGGGCCCGCGCTCTTGCGCCTAGATTGAATTCGTAGAGCAGGGCACCACAGTTGAGCTTCGACACAGTCAGCCACTCGGTCTCAT
CATACCCCTTCCACTTCACAAGGTACTCACGAATTCGTCTCGCTGTCCGAGTCCGTTTAGTCCATCGCAAATCCAGGATTCGCTCAACGTCGTACTCATC
GTTCGCAGCGTCGGGCTCCCAACTGTCTTCAGGCAACAGCGCCGCATCAAAGTCATCATCCTCGTTCACGTCGATCTCCACAGTGGGCCGCTTCGGGAAT
AGTGCTCTGGGTTTCAAACGGCTCACGTCTACCCAGGGATTCATGTGTTCTCGACCCTGAGTTTCACGCGGAAGTTGTCATGGATTTCCTGAATTCTGAA
GGGGCCATGCCACATGTGAGCCAGTTTGCGGCTCAGCCCGGGCGGCACTTTGGGTATATACAGCCACACAGCATCACCGGCTGCGAATCCTGCCTTCAGT
CGTTCGGACAGCTCTCTCCACTTCCTGGTTTGTTCGGCAGAGCGCGCGCGCTTGGCCTTCTTCTAAAGATCCTCAGCGCGAGCATGTGCATAACTATAGT
CACGCTGTAGCTTCCTGCGCCACTCGTACGCAGTGCGCTCCTGGATACTCCGAGGGCCTGGGTCCTAACATTGCAGACACCGTGCCGTGTGCGTCCCAGT
CGTGCACCAGAAAAAAACGGAGTGTCCAGGCGAGTGGCATCGAACGATGTATTCAGGGCAAACATCAGGCGCTCAGCATGGTCGTCCCAGTCACTCTGGT
CCGCCTCAGCAATGTACGCTCGAATGCTGCGCACAACAGTCTGCACCGACCGCTCCTGTTGTCCGTTCGCCTGGGGGCGATACGTCAGAGTGGCTCGCTG
CTTGCTACCCAAAAGTTCACGGAAGCGCGTGAACACCTCACTCATGAACCTTGGGTCTTGGCCGTGCCTCAGCATCGAGCTCGCGCCGAATCTCCTGAAG
ACCTGCTCTTCGTACACTTCAGCGACATCTTGCGCCGTGGTGGAACTCATGGGTTCACACATGACGAATCCTGAGAACGCATCCTGAAAAGGCAGCAGGA
ACGTGTTCCCACGGTCCGACTTAGGTAAGTGTGTCACGAAATCCATAGACACAACTTCAAAAGGGCGCCTCGATTCGATGTTCCCAGGGGAAGGCCCTGG
ATTCTGAGGGCGCCCCTTGCCACTGGCGCAATCCACACACTCTTTGACGAAAACTTCCACATTAGCGTACATGCCGTGCCAGTAGAACTCAGAGTGCAGC
TTCTCGTACGTCCTCGTGATCCCCTGGTGCCTACCCTGAAAATCTTCGTGAGCGTAATGCAGGATATCCGGTCGCAGAGCTTTCGGCACCACGAGTCTGA
GTTCGTCAACCATGTCTCGGGGTCGATCTCTGGTGGACCGACTCAAGCGATACAGGACTTCTCTGGAATCCAACACGAAATCATCAGCGACCTTCGCGAG
TTTCCTGGCTTGAGCGTGCGACAGCTTCGTCGTGTCTCCTTTCAGGAATTCCTTGAGTTGCAGCAGGTGATCATCTTTGTACTGGTGCACTTTGATGCGA
CGCCAGCGTTCCGCCTGGTACTCCAGAGGTCCCATGGGTTCGCTTTGGGCTTCGATCTCCTGAGTTCGTGCTCGAGTCATTACTGCAAACACTCTGGTCG
CCACAGGCAACGGAGCGCACTCAGGTCCAGGGATACCCAGAGTTTCGACACCCTGAGAATCACTCCCCTGAATTTCAACGTTCAATAACACCTTCGGATT
TACCAACTTCTCGTGAATCTTGGACACCAACGGCAGATGTGTTCGTTCCTCCACCTTCCAGGATTCACCAAGCTAGAGGGTCTTAGACGTCAGGTAGTCT
GCGGCCTGGTTAAACTCTCGCTTAACAAGCACCAGCCGTACAGACTTGAACTTCGTCTTCAGCACTTCATAATCGGCCAGCTTCCTCTGGAGATTTGGCT
GATTGCAGCTGATGAGAACCTGGGCTTGCTGGATGGCAATCCTGGAGTCCCCAACTACAACGATGTCCTCAATTCCATGCTCAATCGCCAGAGTGAGGCC
CTTCAGAAGTCCATGATACTCAGCGTCGTTCACAGTCACGTCCTCCAGGGTGGATCCCTGGGCATCCAGGATTTCCCACCCGGGGACATGCCATAGGATG
CAGCCGCAGCTCCCTTGTCGCGTGGAAGTCTTAGCGGCGCCATCATAGCTCAGAATACACCCCTCGTAGTCCGCTTCCAGCATTTCCATACTGATAGGCA
CTGGAGGTTTAACGCGCCCCTTAGCTGGGATCAGGTTTTCAGCGATCTCATCCAAGTGTTCTCTGGGGGTAATACCCGCACCCAGAATTGCAGCCAAGCC
GTCGTCATCCCGTTGAACTCTGCGTATCTCCAGGTTCCAGTGGGACAACTTCAGACCCCACTTCACCGTTCGACCGTCTGCCGACTGCGAGGTCTGCAAC
CACTTCAACACAGAATATCGCGTGTAGACGACGATCTTAGGGCTGCCTTCAACCAAAGTGCGAAACACCTCTAGGACTCTCAGGATAGCAATCACCTACT
TTTCCACAATGTGATACCGCAGCTCAGCGTCATTCAAGACGCGACCTGTGAATCGAACCGGGTGCACAATCCCGTCGTACTCCTGGCCCAACACAGCGGA
TGCTGCCCACGGGTTCGCGTGGGGAATAATCACGAAGGCCTTGAACGATCTGGATGTCTGAGCAACGGAGTCGAAACGATCTTGCGCTTCAGGATTTCAA
AGGCTTCCTGGGCTCTCGACAGGTCTCTCCTGGATTTCACTTGTTCCTCAGTCAGCACGTACAGGACGGCCGCGATCACGGGTAGATCTTCAATGAACTT
GTTGTAGTAATTCAGACTCCCCATGAAACTCTGGACGCCTTTCAGTGTCGTCGGAAACGGCAAGTCTTGGACCCCCTTCGCGATTTTAGGGGTCGCTCGG
ATGCCCTCAGCACTAATCTCGTGAGAGAGGTACGGAATGGACAACTTCCCGAATTCGCTCTTGGGAAGACTCACAGAGATATTCCAGTAACGTAGTCGGA
AGAGCAGCGCGTTCAGATCCTGGCAAAGCTGCTCCCAAGTAGGCGCACCGTGGGCGATGTCGTCGATATACGAGCTTCGACCCAGGACAGGGCCCATCTG
AGAGGGAGCCGGGATGTTACACTGAAAAACAGTCATCTCATCCGTCAACACTGAAAGTCGCGGTGTATTTTCACCTGAAACGCTGGGTTCCCCAGAGTTC
AACCCCAAAAAGTCCAAGACATCTTGGTCGACCTCAGCTTCTTCCTCAGGGGAAAGCCGCAGAAATCCCCACAGACAGTTATTGAAAACTGCCTGGTAGA
TCAGCGGCGCGTTCTTGAGGCCAAACGGCATCCTGACCCACTGGTAGTGCCCATAGGGACAGACGAACGCAGAGATCAACTTGGCTCTCTCGGTCATCTT
GATAGCCCAGAAACCACTCGCCATGTTCAAGCTCATAAACCACATCGCCGACTCAAAGCCAATCAAAAGATCATCAATAAGCGGCAGCGGATAGTGTGAG
AGCTTGATGAAGCCATTCACCACGCGATAGTCGATGCACATCCGGATGTCGACGCCATTCTTCTTGAGGACGATCACGATTGGAGATGCCCAGGGGAACG
TAGAAGTCTCGATCAGCCCGTTCTCCAGAAGCTTCTTCAGAAGTTCATACACCTTAGTCCACAGGTGTGGTGCAATGGACCTTGGACGCTGGGCAACAGG
TTTAGCGTCGCCTACATCCAGGTCACAAACCACTCCAATGGTAGGTAGGGGAGCTGCATTGTCGTCTCCCAAGAAGATCTTCCGATGATATTCCAGAATT
CGCCTCACTTGGTCTTCCATCTCGGGCGTCGTTTTCCTAGGGACTCCAACATCTGCCTCCTCGATCTTGCACTCAGGGGTCAAGTCACGCATCTCAGGAA
GCATAACCAACTGG