Description :
From Genome Similarity Track
Location :
contig_4:951402- 952973
Transcript NameFunction/comments
g1436.t1ETP05249.1 hypothetical protein F441_18123 [Phytophthora parasitica CJ01A1

Sequence
1571 bases(100 bases per row)
TCGTGCACTCGCAGCAGAACAGCGCCGACTTTTACGCATGTGTCGGTCGCTCACTTTCCATTTGATCCAGCAGTCGACAGCCGACAATCGAGTCAAGTGC
ATCAAGAAGGCAAGAAAGCGATCCATCACGATGGCTGACAACTACACGGAGGCCACGACGCCCAAGGCGCCGACGACGGCGTTCGACGAGGCCAACAAGG
CCGCCGCGCGCCTCATCAAGCCCAAGGCCATCCTGTACACGAGTGCGCTGCTGTCGTGGCTGCAGCCGTTCCAGAGCGGTTGGTCCACCTCGCAGACGAA
CCTGTCGCAGTACAACGACACGGACGAGTGCAATGCTCGCCCCGTGGCCGAGGACACGTGCCTCATGTTCCCTGGTCACTCGAAGCTCGAGTGGACGTTC
GCCGTGAACGCGTGGATCTTCGGCGCCATGATCGGCTCGCTGTGCTGCGGCCACTTCAGCGACCGTCTCGGCCGCAAGAAGACGTTGATGCTCAACTGCA
TCTTCATGTTCGTGGGCGGCGTGGTGGAAGCCGCCGTGTCGAACATCTGGGCATTCGCCGCGGGCCGTCTCATCGCCGGTCTGGCGTCGGGCACTGCCAC
GGGCACCATCGGTGCGTACGTGAACGAGCTGTCGCCGCCGCACATGCGCAACACGCTGGGTCTGGGCCTGCAGATCTTCACGACGATCGGCATTTTGTTC
CCCGCGATCTGCTTCTTCTTCGCCAACACGAGCTCTGGCTGGCGCTACCTGGCTGCATTCCCGTGCATCCTGGCTGTGATCTACATGGTGCTGGCGCCGT
CCATGTGCATTGAGAGTCCCGCGTGGCTGCTGACCAAGGGCCGCACGGAGGAGGCGAAGGAGGTAATCGCTCGCCTGTACGGCGAGGAGCACGTGCAGAC
GGCCCTGTCGTGGCTGCAGGTGAGCAAGAAGGCGGAGACCGCGGAGGAGGGTCTGGCTGCTCCCAAGCAGGAGTCGATGTTCGCGCCTCGCTACCGCATG
CAGCTTCTCGGCGGCATCATGCTATCGTGCGCGCAGCAGCTGTCGGGTATCAACGCCGTGTTCTACTACTCTGGCAGCATCTTCTCGGACGCCGGCATCT
CGGACTCGCGCGTGGGCACGCTGATCATCGACTTCATCAACATCTGGCCCGCCTTCTTCACGGGCGTGCTGGCCAACCGCTTCGGTGCGCGCAACATGAT
CCTGTGGGGTCTGGCTGGCATGTTTATCATGTCGGTGCTCATGACGGTGGCGTTCATCGTGGACGTGTCCGCTCTGTCGATTGTGTTCACGGCGCTGTAC
GTGATCGCATTCGGCGTGACGCTGGGCCCGCTCGTGTGGGTGATGACGGCCGACATTTTCCCGGACTCGATCCGTGCCAGCGCGTCGTCGCTGTGCATCG
GCATCAACTGGCTGTGCAACCTCATCGTGGGTGTGGCTTACCCGTACATCTCGGACGCTCTGGACGACTACGCGTACGTTCCGTTCGTGGTGCTGCTGGC
GATTTTCTTCCTGTTGGCTCTGAAGCTGGTGCCGGAGACGTCGGGCAAGTCGGCCGAGGAGATCCTGGCCG