Description :
From Genome Similarity Track
Location :
contig_7:95135- 96595
Transcript NameFunction/comments
g2002.t1mitochondrial import inner membrane translocase subunit TIM50

Sequence
1460 bases(100 bases per row)
TTTAGGAATTCTGAGACTTCCGAGCTGCTGGCTATCGTCCTAGCCACTGCGAGAAACCCTAGAGCGTATGGGGTGGTCTCATTGAAAGAGGTGCGGCTAT
GGGGATCTCCTCCTCGTCCGATCACAGACGAGATGCACAAAAGACTGCGGATTCTGGAAGGCTCAGGTGTCTATGGACTTCAACAACGTCACTCATCGGG
AAGGCAAAGCCAGTCGCAAAAGGCACCAGAGACTAGTCGGCGCATTCAAGTAATGCCCGACCGCAATTTCCAAGAACCGAGTTATCCAAACCTCGCACTC
CAACAAGAAAACAACGAAACTGACTTGATCTCTGAAGGGAGAGGGAAGAGGATAGTATTACAGGGCACACAACTTCTGTTTCATTGCGAGTACCTTGCTC
TGGTCGAGTACATCGAGTGCGTCATCCCTCTGATTTACATGGTGTATAAATCCGTACTTTCTCGACTTCCGAATGCAGCCTACTTTCCTGATGCTGGCAA
TTGGGGCACCACTGCAGTCACCAATTTGCTGGTATTTTCAACGATAGAAGTCGGGTCGTTCATTTTCTTTAACGCGCTTGTGCAGCGGAAGTTTGGCTTT
TCTCCGCTCTACCAAGTTGCGTTTGTACTTGAAACGCAGTTTGCTCCGGTGCAGGCAAAATTATTCCTCGAAACGATATTTCTACTGCAATACGAGCTTC
AACACTTGGGTGAGAAGCTTCAATTGCTGATATCTTTGGTGACTGGTAACTAAATCGTACTACTATCCCATACTGCTTTGTAGGAGCTGATTTCACATTC
CAATTTGAGTGGCTCCGCAGTCAGGCTGCAGTCTGAAGTTGATCTCCAACGATTAGTATCAGAAAGTGTGAAAGTCTCCACTGTCCCACGTCACGACCGC
TCAGTACTTTTGGAGCCTGGTAAATAGTTCGTCAAGAAAACATATCTCAATGTCGCGTTGTATGACAGTTGAATGAGCAAAGAATCCAATCGTTTCTCTC
TCTAGTAGTAAATGCTCCACGTGCGATGGTGCGGCAGGAGATCTTCTTTGTTGTCCTCTCCAATTTGCCATAGCAGCCAATCCAGCTCAATCACCTGAAG
ATGATGACCTTGGTGTGCCATGTGATTGTGGATCATTTCGACCGCCTGGATGGTTGCAGCGCGGATTTCAAGTTCCATCTGCAGAGCATGAGTTTAGCAC
AGTGACCATCTTTACATAAGAAATTGCGTAGAATGTAAATTGCATAAATGAAAAGGACTCACCTCGCTTCCGGCCGGAATCTCACCTTTACTGTCAACCA
GTTTAGCGAGATCTGCTGAGTACACCATCACACCTTCCGGTCGAAGCACTTGGGGAACGCGATAGTCAGCTAATGTCAAATACACGTAACAGAGAAAATC
ATGAGAAAACAGCCTAGCATGCGTTGCCATCATCAGGCCAGTGAGTATCCTACCGAACAT