Description :
From Genome Similarity Track
Location :
contig_200:9510- 12026
Transcript NameFunction/comments
g14732.t1RAW26666.1 Transposon Tf2-6 polyprotein [Phytophthora cactorum

Sequence
2516 bases(100 bases per row)
GAGCGCTTCGCTGCGCAGTCGTGGGAATCGCTGAAGGCGTCCGGCAATCCGGTCTACGAGACAGCTCGCGAGTTCGCCGACGTCTTCCCAGACAAGATCC
CTGCGGAGCTGCCAGCGGATCGCGGAGTGCGCCACGAGATTGACCTCGTGCCTGGATCGAAGTACTGCGTGACGCGGCAGTGGCCACTGCCGCGCGATCA
AGTCAAGGCCATCGACGACTTCTTCGAAGGCCGCCAAGCCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACCTTCTGTGTGAAGAAGGCT
ACTGGCGGGTGGCGCATCGTACACGCCTTTAACAAGTTGAACGATGCCACCATCCCGGCGCAGACACCGATCCCGCGGAAGGACATGGTACTGGACTCCA
TGTCGGGCAGCGTCATTTACAGTGCCATCGACTTGACCGATGGCTTCTATCAGATCCTCATGAGAGAGAGCGATGTACCTCTCACGGCAGTCAGTACGCC
CAGCGGTATGCTCTGGGAGTGGCTCGTGATGCCCCAAGGTCTGAAGAACGCACCAGCCACATTTAATCGCATGGTGTCCCATGTGCTACGCCCGCTTCGT
GACTTCGCTCCGAGTTACTTCGATGACATTTTTGTGCACAGTCACGCTGAAGAGGGTCTCAGCGCGATCGACGTGCATCTGCGGCACTTGAGGCAGGTCT
TTCAAGTGATGAGAGAGAACAAGCTCTACGCGAATCTCAAGAAGTGTGTCTTCTGCGCGCCGGAAATTCCGGTGCTTGGGTGCTACGTAAGCAAAAACGG
AGTCCGTGCTGACCCGGAAAAAGTGTCGTCTATTTGCTCGTGGCCACCACCATCAAACCCCACTGAGCTGCGTCAGTGGTTGGGCCTCGCTAACTACTTG
CACAAGTATACGAAGGGATATGCCGGCTTGATACAGCCACTGTCGTCGCTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCCCCGAGCATCAAGTAGCCT
TCGACTCGGTGAAGAAGAGCTTGGCCTCGGCGCCAATACTGATGCTCCCAGATGACGCGAAACCGTTTCACGTCGTCTGCGACGCTAGCGACTTTGCTAT
CGGGTGCGCGCTCATGCAGTTTGACAACGAAGGCCGAACGAGTCGTGAGCTATCAATCACGACAGATGAAGCCGGCCGAACGCAACTATCCCGTCCACGA
CAAGGAACTTCTTGCGATGCGATACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGAGAACAGACGTTCGCGGTGTACACGGATCACGCATCGCTGCGC
ACAGCGATGAAGTCTCCACATCTGTCTCAACGCATGGCACGATGGCTGTCGTTCTTCGCTGAGTACAACTTCGTCGTGCACTACAAGCCCGGCAAGAACA
ATATCCTCGCCGATGCTCTGTCTCGGCGTCCAGACTATGATCCACGAGCGACGCGGGGTCGTCAAGTGATTGACGAAGACGAGGATGACGAAGATCACTG
CGCGATGTGCTTGACATCAGGTGTCAACCTGATGAACGTGACCCAGAAATGTCGCTACGCGAAGAAATCGCCGTTGCGTACAACGACGACGCGGTATATG
CCGCCATCCTCGCACATCTTCTTTCCCCCAGTGATAAAACACTCCGCGCGCTGCCGAATAACACGCGCAATCAGATTAACCGATATCAACTCGACGGCGA
TCTGCTGACGTACAGCATCGATCGATTCGATGCTCCCCGCATCGCCATCCCGAACGACGATGATCTGCGCGCTCGGATCATCCACGAGTTCCACGACAGC
CCTGTCGGTGGTCACTTGGGCCGCGAAAAGACGTTCGCGGCAGTATCCCGCGACTTCTACTGGCCCCACATGTACAAATGGGTGCGCAAGTGGGTCCGTA
CTTGTGAGATTTGCCAGCGCGTGAAGCCGTCAAAGTCGTCGCAGGCTCCCCTGCGACCCCTGCCGATTGCAACTGAGGCGTGGCGCTCAGTGTCGATGGA
CTTCATCTTCGGGCTTCCACCCGATGCCGACGGTCGGACTGGCGTCTTGGTGTTTGTGGATAGGTTCAGCAAGATGGTGCATCTCATTCCGGTGTCCGAC
ACGATCACCGCGGCTGAGTCCGCGGTGCATTTCGTTGACGCGGTCTTTCGACACCACGGCTTACCTGAATCGATCGTCTCTGACCGCGATCCGCGGTTCA
CGTCGGCATTCTGGTCGAGTCTCTTCCAACTTCTGGGAACGAAGCTGCTCATGTCAACGGCGGCGCATCCGGAGACGGATGGTCAAACGGAGCGGGTCAA
CCGAGTCCTCGAAGATGTCCTTCGAAGTTACGCGACTTCGTTCACTAGTTGGAGCTCCTTTTTGCCGCTTGCCGAGTTTGCGCTAAACAACGCGGAACAC
GCATCGACGGGTCTGACCCCTTTTTTGTAAATAACGCGCGGCACCCGCGCGTTCCCGCTCTGCTCGCCGTGGGCCACCCCACGATGCCTCGTGGCTCCAC
TCTGGGTGGGGAAGGA