Description :
From Genome Similarity Track
Location :
Scaffold_2600:951- 3086
Transcript NameFunction/comments
Phypl_g15241putative polyprotein

Sequence
2135 bases(100 bases per row)
CTGGAAGCatttcctgcgcgacctcaagGCCGGCGACATCGAACAAGTCTGCTTGATCACCGACGCAGACACGACGGTCCACGCGGTCCACGCAGTCTCC
GACGGcgactcgccgtcgcgtccCAAAAGCGCTGAACCGAAATCGGCTCGTGAAGAACGCTTCGCGGCACAGTCGTGGGAGCCGCTCCGTCAGTCTGGCA
ATCCTGTCTACGGCACCGCCCGCGAGTGCGCGGACGTCTTCCCAGACAAGATCCCCGCCGAGTTACCGGCGGACCGTGGCGTTCGTCACGAGATCGACCT
CGCGCCTGGCACGAAATACTGCGTGACTTGCCAGTGGCCTCTACCGCGTGATCAAGTCAAGGCtatcgacgagttcttcgagggCCGCCGCAAGGCCGGT
CACGTGCGTGAGAGTATCTCACCACACTCGAGCCCGACCTTCTGCGTGAAGAAAGCTACTGGTGGATGGCGCATTGTTCATGCGTTCAACAAGTTGAACG
ACGCGACCATTCCAGCGCAGACGCCAATCCCGCGCAaggacatggtgctggactCCATGGTAGGCAGTGTCATCTACAGCGCCATCGACCTGACCGATGG
TTTCTATCAGATCTTGATGAGAGCCTGCGATACACCCCTCACGGCGGTGAGCACTCCGAGCGGTATGCTCTGGGAGTCGCTGGTGATGCCTCAGGGCCTG
AAGAACGCGCCGACCACCTTCAATCGCATGGTATCCCATGCGCTGCGCCCTCTTCGCGACTTTGCACCAAGCTATTTTGATGATACCTTCGTGCATAGTC
GCGCCGAGGGTGagctcagcgccgtcgaAGTCCACTTGAAGCACTTGAGGCAAGTCTTCCAAGTGATGAGAGAGAACAAGTTGTACGCGAACCTGAAGAA
ATGTGTCTTCTGCGCACCGGAGATTCCGGTGTTGGGCTGCTACGTGAGCAAAAACGGAGTCCGCGCTGATCCAGAAAAGATATCGTCTATCTGCTCGTGA
CCGACTCCTACGAACCCCACTGAGTTGCGTCAGTGGCTGGGTCTGGCAAACTACTTGCACAAGTACACGAAAGACTACGCCGGACTCATCCAACCActgt
cctcgctgctgaagaaggacaCCGCATGGGAGTGGCGTCCAGAGCACCGAGAAGTTTtcgactcggtgaagaagagcttAGCGTCCGCGCCTATCTTGAT
GATCGCGGACGACTCGAAACCGTTCCATGTAGtctgcgacgccagcgacttCGCCATCGGTTGCGCCTTGAtgcagttcgacgacgaaggccGAGAACGT
GTCGTCAGCTACCAGTCCCGCCAGCTGAAGCCGGCGGAGAGGAACTATCCGGTGCACGACAAGGAACTATTCGCCATGCGTTACGCTCTGATCAAGTTCA
GTTTACCTGGTTGGAGAGGAAACGTTCGCAGTCTATACCGACCATGCATCGCTGCGCACAGCGATGAACAGCCCCCATCTGTCGCAACGAATGGCGCGCT
GGCTCTCGTTCTTCTCTGAGTACAACTTCGTGGTGCACTACAAGCCCGGCAAGAACAACATCCTCGCCGACGCTCTGTCTCGGCGTCCAGACTACGATCC
ACGCGAAGGACTGGACCGGCAAGCGATCCGCGAggcagacgacgaggatgactGCGCCTACTGCATAGCGTCAGGCTTGAACCTGACGGTATCGTCACCG
AAGCTATcgctgcgcgacgagatCGCCGCCGCGTACGTCGGCGACGCGGTTTACGCCGACATCCTGACGCACCTTCGTTCACCAAGCGAGGTGACACTCG
GTGCACTGTCACGCTCCACGCGCAGTCACATCGAGCAATATACACTCGACGACAACTTGCTATCGTACACCATCGATCAGTTCGATGCTCCCCGAGTGGT
GGTGCCCAATGACGAAGACCTTCGCGCCCGGATCATTCATGAGTACCATGACGCGCCTGCAGGTGGCCACTTGGGGCGCGAAAAGACCTTCGCGGCAGTA
TCGCGCGACTTCTTTTGGCCCCACCTGTACAAGTGGGTCCGCAAGTGGGTGCGCACTTGCGAGCGTGTGAAGCCatctgcgtcgtcgcaggCTCCCCTGC
GGCCGCTTCCGGTTGCCACGGAAGCCTGGCGCTCC