Description :
From Genome Similarity Track
Location :
Scaffold_2193:951- 3007
Sequence
2056 bases(100 bases per row)
ACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCC
GGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACG
ATGCCTGACCCTCTGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGAT
CTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTT
GACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCG
GGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGC
GTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCA
AAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCAT
CTTCTTGGGACTCACGGTGAAATCCCGAGTCTCCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGAT
CCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCCTGTGTACCCGTCGGTAGGG
CGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCCGTGGAAAATCTT
CACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGT
GTGTTCCCTTGCCTTTGCGTTTTCCTTTGCGTTGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGATCTTCTAGGGTGTAACCGACCAAGTAG
TAATTCGATTAACCTGTTGTATCTGCACGTGGATAGGAAAAGCTCACTAGGTTGTAGGATATGGCCAATGTATTATCCAGTTATCACTACCAACACTAGG
CTCGCAATTCCCAACCTTCTCCGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTTATCGTGCAAATAGAAGTCTGT
ATTGATATTTAAGCCTATACCTGCCTGGATTTCTACCTTCTATGTCTTTCACCTGCTAAATCCCTTACCAGGTTCGGCTGCATGTCCCTTCTTCCCTTGA
CCCATCATCCCAGCTGTGTTATCTTCAGATCCACCGGATCCATGACGTAATCATTATGGTGACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTT
GGATCCACCTCACTGTAATTGTACACTCGCCGTGGATCCGAGCTCTTCAATCATCCAACATCATCTTGCAACCGTCTGTGATCTCCATTGTCCCACGAAA
GTTCGAGATCCACTGCATCCATCATCCCTATACCCTGGATCCAGGTCCCTCAAGGCGGGATCCTCCCTCCATGGATCCGAACTCGGAAGTATGGGATCCG
GGGCACCTCGCGGTGGATCCTGACTTCTCGTTAACCGTGGTTACTAGATTCACCTTCAGAGGGCACCTACCATCATTCCTTCATAGGATCCACACTCGAT
CCACTCTTATATAGTATATCCCATATCCATCTAAGTGGATCCAGGTAAGGGTGGAT