Description :
From Genome Similarity Track
Location :
scaffold_993:951- 2135
Transcript NameFunction/comments
g10788.t1 hypothetical protein PHYSODRAFT_310535

Sequence
1184 bases(100 bases per row)
GCGGCGACTACTAACTACTTCGAACGGCACGTCCTTGTCATCCGTTTCATTGTCAGTTGGTTCCTTTCCGAGCCTTGGGATCATGGCAAACTGCATCTTG
TTCATGACGATGAGGTAGAAGATCGCATTCACCACCATCACACCAGCAATCGTGAAGTACATGTTTTCCATGTGACCGTCGTTCAGGTTTGCAGGAATAT
CCTTACCGAACAACAGCACAATCACAGACAGCAGAGTGCTACCCATCGAGTTCATGAAGAGACCCAAGGCGACCGACACTCCACGGAGAGCCATCGGGAC
TTCTGTATACGCGATGTTGTACGTCGGAATCTGGATAAGGACGGTTGCTGCAGCCACAAGGACGTACTGGGGAATAGCATTGTACCAGCGAATATCGCTC
ATCGGCTGCCCACCATTGTTGTTGTAGATGTACTGCGTTTCACCACTTGCGTCCACGTATGTCAGAAGCGGGGAATCACGGCGGATAATTTCAAATACCC
CCGTCCAGACCATCGCGATGATTGCCACAACGTAGCCAGCGGCAACCATTCCGTAGCGGCTGGGTGGCTTGCCAGCAAACTTCTCGTAGATCGGATAGAC
CAAGTTGTGGAAGAACGGCACCAACAAAAGCCCAGGTCCGGGGTTAAAGAATTGGACGGTCGGTGCCGGTATTTGAGTTGAGTCAGGAGAGCTACCGAGA
CGCACATCGGTCTGCTGGATGATCGTTTGGTTGTTGCCGCGCTGGTTCTGGCAGACCCACCAAAACATGTTGAAGGCGTTGAACGGGAGGATCCGAAGGA
CTTGCTTCACTCCACGAATCAGCTCCTGGTCGAATTCAGAACCATCACTGTTGGTGGCACTGTCAACCATCGACACATCTTGTCCAAAGTAAACCCACAA
AATGGTAGCGACCATAATCATCACACCACAGACGTACGAGATGTTGTGGCCCGTTTCACCGTCATCCGACATGAACGCCGCGATGATGTTCAGGAAGAAA
GCGGCGACGTACAGGATGGTTCCCAGTACCATCATTTTAGCGTTGAGGCTGTGTCTAGCGCTACGGACAATCACGTGGATCACACTGACAAGCGCACTCT
TGGTCGGGGGCACGTTGATGTACCGAGACCGAGTAGACAGCAGATTCACGATGATCGACAACATCAGCGCCAAACCAATAGCGA