Description :
From Genome Similarity Track
Location :
scaffold_614:9508- 18870
Transcript NameFunction/comments
g9507.t1hypothetical protein
g9508.t1hypothetical protein

Sequence
9362 bases(100 bases per row)
GAGGTTCAGCAGTGGATAGACGCGAACGAGGACTTCTGGGAGCAACAGGAGGCGGATGCTATCGTTTATATATCCGGCGGTGCGAAGGATGCGGCTGGCA
ATTTCTACTTCGCAGGCTCCAAGACTCTGGACATTTCGAAACCCGACCTACTCAACATTTTTGTAGCTTGTGTCAACACTGACGGAGCTCTCGACTGGAC
CAAAGAGGTAGAAACCCCTGAGTTTTAGGAGATCTTTGCATGAGTTTTACTTACTGTTGGGGTGATCATCTCCAGTGGGGGACAGACCAAGCAGATGCAG
CCACTTCTATCGCCATTCTCAACGATGCTGATGACACTGAGTTTCTCTACGTTTCAGGGTACACATGGGGCTATCTGGATGAAGGAGGTCACGCCCTCAA
CGGCTTCGGTCAATACGGAGGTCGAGATGTTGTGCTGCTCAAGGTCTCGCTAGAGGGAGAGAAACTCTGGATGCGTCAGTTCGGCACGACCGCCAACGAC
GTCGCCGACGGAGTGAAGCTGGACGGGAGCTTTAACACGCTGCTGCTCTCCGGTGGGTGTGTCACGAGTCAAGTGGGCGGGTCCAACCGAGCCTACGACT
TCGCCGTGAGTTTGAGTTTCGATGGAGATATTCTGGATTATACGATGGATGGAGGAGTGACGCTGACACCGAGAAGGAGCACAATCAGAGAAGGAGGGCT
GGTGGCGGATTATGCTGTGGTCTTGAACCGCCAACCTGTCACTGACGTCGAAGTTCAAGCTCAAGACGTTCGTCTGCTGGATCCAAGCAATAAAACAGTT
CAACAACTCCAGTTCTTGACGTCGCAGCGCGTGGTGTTCACACCTGAGAACTGGAATCGAGAGCAGTTCGTGCAGTTAACTGCAGTGGATGACGATCTCG
CAGAGGGAAGGCACTACGCCGTTGTGGCTCACACTGTAACGAGCTCCGACCCGAATTTCAAAGAAAACACGCCGTTTCTCGCTGGACGGACCGTGACTAT
ACAGATCGATGACAACGATATAGCTGGCGTATTTCTCTCGAGACAACATGTATTTGTGGCCGAAGGAGGCGGTAAGGACAGCTACGAGATCGTACTGACG
TCTCGTCCGTGGCATCCGGTCAAGGTGGTGGTTAAAGCTCTTCATGCTAATCAAACTGCGGTATTCTCCGAGGCATCAAGCGCAGAAGAAGACACAGTAG
AACTGACGTTTCAACCTGACGACTGGAACAAACCTCAGCACGTTGTGGTTAGTGCCGTGGACGACGTTGAATCCGAAGTGGAGTACGGTGGACTGTACAA
TGGAGGCCCGTTACTTCACTACACCGAGAGTAAGGATATTCGGTACCACACACGCCGTCCCCAATGCTTCGACGCACCGAATTGCGATCCCGATGACTCT
TTAGTCTGTTTACTGTCCAAGGAAGAACTGAAAACTGGACAAACCGTTGTTCGAGTATGTGATTTAACCCATGACTGTGCCTTCGCACAAGGTAATGGAG
CGTGTATTGCCAATGTGGTAAGTGGGAATATCCCAAAGCGCTTCGGAAATCCACCGCTGGACACTAGCAGCAGTGATACCCCAACACATCTGAGCTACAC
GGCGCTAATTGAAGTGCTGGCAGCCGAGAAAAGCGACTTGAGTCTTTCAGAAGAACAGGTTTTATCTGAATCGGATTTTGTTCCGCCCCCGCCGGAGTTG
AGGGGCTTTGTACTCAGCTTCCTGGGACTGATGAACATTGAACAAGCCCGGAAGATGAGTACCAGCCCAAGGGATGTCCAGCATACACTTTGCGCAGGCT
TGGTACGACTAGAAACGATGCGTTGGGCATACGAAGGATGGCCTGTGGGGTATGTAAGTCGTGTGTTGACTGCTGCTTTCGCGATGTTCCCTAAGAAATA
TTCACTGGAGCGACATTCGTGGAACTGCGGGATGGCGAACTTCCTTCCTGACAGCACAATCGACGTGAGTATCTGGGAAAATGACCCTGGAGTCACGCTT
TCTACCGCCGACTTGGAAGTACTGGAAGGAGATTTAACTGGCGCTGCGTACGATGTGGTTTTAAACGCCCCGCCATCGACAGGCCGCGCAAAGATCGTCA
GTACGAATGAGTTGCCCGTGTCTTCAGCGTATTGCAAGGATGAACAATCGGATACGTGCGGGTTCTGGGGAGATTTTCAAGCTCTAGCCGCGGAGATCTA
CGACCAGTCAGCATGGATCTCGAAAGACGCTCCAAACGTGAGTATTGCGATTGAAGGGAACTCGCAACTCACGATTTCTCCATCGCTTTTAACCTTCACA
GCCACGGACTGGTTTAAACCGCAACGCGTTGTGGTGCGAGCGGTGGATGACGCAGTGGCTGAACCTGACGTGAGCTTCACAGTTTCTCATCGAGTACAGA
ATTCGATGTTTGGGTATTCGGAATCCACCGCTTTCTGGTTCCAAGGCACAAACACGAGGGCTAGTGAGTTGTATTCAGCTTGGGATGGTGGGTTAATCCC
TTATAACCCGTTGCCCACAGTTCTCCATTCACCAACTCACAAACGGGTGACTGTTTTCGTGCGGGATAATGACGTCGCAGAGGTTAACGTGGTAGTTAAC
CAACCAGAAGCGACGTTGGCAACGAAAGAAGCCAGTGATACGATGAATTGGGTGGGCGACTACGTCACAGCGCTGGCATTCCACGATGTGTCGGTGTCAA
GTGGTAACTCCGAGGCAGTACTACCGGATATCCTCATGCTGGGTGCCGATGTGGTGACGTTTATGAAGTTCCATCTGCCGCATTTGCACGAAGGGGACAC
GTCTCTCAAATACTCAAAGGCAATGCTAGTGCTTCATCAAACACCGTACGAAACCTTCGACGTATCTGAGCTTGATAGCGGTAGTTCAGCAGCTGGGGTG
GGGGTTACGAGGGAATATGTGTTGAAAGTGACAGCCGTGACCAACGCCTGGACAAGTGGAAGTATTCGAGAAGGAGCAACCCCTCGACCTCTCTCTTTCC
TGAATGAGGCGTCCATTGAGATCACTGCAACTGTGGAGAAAAGCCGCTCGATTGAAGCGGATATTTCCCCACTGCTAGCGGAGATTCTACCGACTCGATT
GTCTGTAGTTTCGCTGAAGATTCAAGTGCTACCGGAAGGAGGAAAGTCAATTGCTACGACGCAGTTGTGCTCTTCGGTGTTTGAGAGGAAGCTACGCCCG
CTGCTATCTCTTTCCTACGCGTTCTCGAATATCCTAAGTGGTTTAGCAGCTACTCAGAGCTCAACGGCAGTGGCTTCCGTGACTGAAGCTTCCCTCGCTA
CTAATGGAGCTCAGTATGACGATTCAATCGACAGTACAGCTATGGTAGCTACCACAACGAGTGAAAAGGAGCCATGGTGGGAAGTACTTCTTCCTCAACT
GACAAAACTGGGGACAATAGCTATTTTTCTGCCCGCTTCAATGGTTAAAGAGACCTCGGACGCCTTCAACATTATTGTGATTGCTTCTCTGAAGTCATTT
GACGCGCAAGTACTCGCTCTAGATGACGCACTGACCAATGGTTGTCCAAGTGCGTGTCCTAAAGTCGAATATTTGCCAGTTCGGAGGGGAATTTTACTCT
GGAACGTCCAAGCTGGTGCAGTAGCAGTGAGAATTTACCGTCAAGGCGTCGGAAGTCTACAATTGGCACAAGTTCAGGCGTTTGAACCCTTTTTAACAGT
AACTCTTACAGCAGATGGAGCTGGGATCCGTTCCCGACTCAAATCTGATTGGGGCCCAAGTCCCGTTTTGTTGCAGTCATGGCGTCTCCTCCAGACTGTA
AGGAGGTCGGAGAACGAGAACTTGGCGCTTGGAATGGCTACGAGGCAGAGCAGTACCCAGCCAAGCGATGCGTTGGCGTACTTGGCTGTAGACGGTTTGC
AGCATACTGGATGGGACCCCCTTATTATCCGAAGTCAAGACGATAGGGCAATGTCGGCTCGTAGTACGCGAACGGGCGTGGAAACGAATCCGTGGTGGGA
AGTTGACCTGGGCAGAGTGAAGCCTATCCGTTCCGTTGTCCTGTATCCTTACGTTGGAAATCTGTACGAAGAACACTGCGCAGGGGGTGGAACCAATGGT
TTTCCATCGTGGAGTGGCGATTTGTATGACTACAGTCACACCGACTCTTTGCTGCAGTTGAAAGCCCCGTTTTCTCAGCAGTTTGACGTGCTTTTATCCG
ATGAATCGTTGATGACAAGCGACGGAACTGCGTCTACAGCTTCTGTTACAATTAGTAAGACGCTGTCGTTCTCGTGCGCGAGTTACACGAACTCGGTTGC
GTGGGAGAATATCTTCTCCAAAGCTCGCTTTGTGACTGTACGAAGACGCGGCGCTGGTGTTTTAATGCTGAACGAGGTCGAAGTTCTACGCTGGAATCCA
GTCACTAAATCGCGCTATCTGCTGCTGGACTTGTTCGGAACTGGAGAGAAGCCCCTAGCACTGTCTAGTGTACAAGTCTTCCCTCCGAGTGATGTAGTGC
CTACGGATTCCAAGACTCTAACTGCCTCGGCTCCGTTGAGCTACAAAATCCACAGTGTGAGCTCCCAGCTTCCAGACTCAGCCAGTGCGCTGTTGAACGC
GAAGGACAAAACCTCTTGCTACGTTGCTAGTGCTCCTTCTTACCACGAGTGGCTGGTTCTGGAGTTCCAAGTTCCCGTGGAAATTGGGCTAATTGACGTC
CAAACACAAGTAGATTCCTGTTCGGCTACGAACGTGGAGGCTGTGGCTGAATTCTCCGTCGCTTCCCATGGTTCCGAGCTTACTGGTATTCGGAGTGAAG
CTGCAACTCAAGCTTTAACTGAGACGTCTTCGCTTTGTGAGCTAGATGCAGCGGGCGTTGTGGTGTCGCCAAGCCCTCAGTGCGCAAGCTTCACTTGTGA
TAAAAGTTGTCAATCCCCTCTTCGAGTCGACGGTTTGGTGCTAAGTGACTTCATTGACCTTGCTGTCCTCGCGAAATCCGAGTTACTACCGGTGAATCGA
CTCCCGTTATCAGTTAATGAGAACCGCGTGCTACTACTTCGGGCCAACCCTGTCGTTATCTGGCCGTTCGACGACACCCCCAAGGTGTTGGTTAGCAATG
ACGAAGGCGAAGTTTCGTGGGATAGGAAGGGCAGAGCGACCGGCGCTTTGGAGCTAAAACCTGCTTCAACACCAGTGGATTTGAGCATCAGTGATCACTT
GGAAAGTACCTTTTTCTCGTCTGCAATGGCAATTCAACCAACCATGAGCTCGTTCTCCCTGGAGTTCTGGTTCCAAATCAACCAGAACTCCATCGACTCG
GTGGCCGTTGCCACCCTTAATGGTAAAGATGCAAGCGGCGACCAAGTAACCTTTGGAATTGTGGGATTCAGTAGTGAGACGGAAAGATTCTACTTGAAAA
TGACCAACCCGGAGAACGGAGTGGTCTGCAGAGCGGAGCTGGCCGACGACGCCGAAGGTTTACCCTTTGCAGAACCTTGGCATCAGGCTGTGGCGATTTA
TGACCCTGTTTCGTCCAGCATCTCGTTCTCCGTCTGCGTCTCGAGCGAACTGCAGAGCGCCAACTGCTTTACAAGCTCGACGTCTTGTAACATGGCATTG
CTGGATTTATCACAGAAAATTATCCGCTTCGAGGGTGGCTTCGCTGGGAAGGTAGCGAGTGTTTCATGGTTCCTTCGAGCGCTGGCAACGACGGAGATCC
TAGACCACTACCACGATTTCCTGGGCGGGGTCTCTACTGAAGCCACTGCAGCCCACAACACGTACTCCATCGCACTATCAGCCAAGCCGTTGCAGCCTGT
TACCGTGAAACTCAATGCGGAGAGCGCGTGCTACCGCTTCAACCTGTGCGACGTGTCAACTATCCCGTCCGTACTGGTGTTTTCGATAGAGAACTGGAAT
TTGCCGCAACTTGTGCATGTTTTGGCCACGAACGACCAACTGTACGAAGGTTTGCACTCGGCGGATGTTTTCCACGTTGCGTCCAGTCCCCCTCTGTATC
AATTGACCAAGAAGGCGAGCACTTCCAGTGTAACCAGTGGGGACCTTTTATCCAAAGTAGAGGATTCGGTGGCGGCATTTTACCGCGATTTCGTTGTCTA
CCGAGTTCTCGAACAGCTTGATGACCAGAGTGCACGCCAGGATGCGCTGATGGATCTTCGTTTGTCCTGGGCTTCCCAGTCTGTACAGCAAGCTATCGTG
GCTGCTAATGCGTATGCCGAGGCTATCTCAGTGGCGTCTGTGGTGGTAAGTCTTACGGACGTAACTGTACCGGGCATCGAGTTTTCGACGACATCGTTGA
GTGTGTCGGAAGACGGGACAGGCAACGACTATCAGGTGATTTTACTTTCCAAACCAACGAAGGAGGTTCGCGTGACGCTGGACATCGCCTCCGGTTGTTA
CCGTCGGTGTCGGGACATACCTTTGTGCCCTTCGCACACAGTTGAGCTCTCGGATGGGAAATTTGCAGTGGCAGGAGACGACTCGTTTCTGACTTGTGGA
GATGGGAGTAAGAGTGTGATCACCAGTAAATTACTGTGTAACATCACAGTATCTCCGGACGTCCTCGTTTTTACTACGAACGACTGGAATTTACCGAAAA
CGGTACGAGTTGTTGCAGTGGACGACCATCTCGACGAGGAAGACGTCCACGTGGCAATTATTCGGTCAACAGCACAGAGTTCCGACCCCCTTTTTGGTGC
TATCATGCTGCCAGACATTGTCGTTACCATCGCAGATAATGACGACACGGATATGGTCTATTCAACCAAGCTTGTTTCTCTCTTTGAGAACAACGCAGCA
GTTTCAGCGCTACATTATCCTCACACGGATTCTTACACGCTTCAACTGCTGACAGAACCTTACACTGATGTCGCAATTACGATGAGTAACGAGGCCAACG
AAGCGTGCTATCGACAATGCGGCTACCCTTTTGATGGACCTTCGTGTGGCGTACCTCGTCAGCAAAGCGTCAGTTTAGTTCATCTAAGCTCGATTTCGAC
CCGAGAGATCCACCAGATCTCCTTGAGGATGGACAAGATCACCGAAGTGCAACGAATTGCGACGCACGCGGACCACGTCGACCAGGTTTTCTTGCTTTCC
GTGTCTGGAGGATTCAGTTTCGAGATCCAAGCGATCGTTTTCACGTTTAACGATGATTTTAAGTCGCGTTTTGCGTCTGCCGATGCTATCGCTTCCGCTA
CAAGTTACGGCAGTACCTTTGCCGTCACAAATGGCGACGGTTCCAGCACTTCTGGCCTTGATCTGTTCGCCACGGCTGTGCAAGTTCAAACAGCGATCAA
TGGGTTATTTGCCGGTGGAACAAACGCTGTTAGTGTGGATCGAACCATTCAGTACGCAGCTTCAACGTTGACGTGGAGTGTGACATTCCTGCGGTTTGTG
ACTTCAGATGGGACTTTTCCGTTGCTTTCTGCATCAGTTAATGGCGCAATTCTAGGCGATGTAGCCTGCCAGCGCACTCAAGCGAGTATTTCTCCAACTG
GGACATTCAAATTGAGTTATGGGGCAGCTACATTCTCACTAGCAGTACTACCGACAGCTGAAGCTCTTGAAAACACTCTAAGCTCACAAGTGGGGGTGCA
TTCTGTGTCGGTCTCAAGGAGATTATTGAGTAATGGAGGCTACGGGTTCGAGTACATCGTCACTTTCGTGAGTGTCGAGACCTTTTCCAGTCTCGCCGTC
AACTCTACGTCTATTGTGGTGGCAAACATGAGCCAAGTGGCCATTACAACGACGGAAACGCAGTCACCAGTGCTGATGAAAGGGGCGTTTGTGATTGACT
ATTTTACCCCTCTCAACATCGCTACGACTAAGCCCAACCGTAGTGTACCCATCTTTTGGAATGACTCGGCAGAGACACTTGCCACTAAGTTAGGACAGCT
TCAAGGCTTAGCGAACGTGATGGTGTCTCGCGAGAAGCTGTCTGCGGAAGGAGGGATGGTGTGGACGGTTCAGTTCCTTCATAACTATGGGGATTTACCC
AGTCTGGTTGCAACGTCTCTAAATCTAACGGGTAAAGGCGTCACAGTTGGAGTGAGTACAATTCGTGATGGAGAACCTCTGCGTGGGAACTTGATGATCC
AAATGGGAGGCTGGTTTAAGAAGACCGACCCACGTACAGGCCGCGCGTACATGATGGATCTCCCGTTGAAAAATACCACATTGTTGCCATTCAACGCCTC
GCATTCGAGTGTTCGGGAAGCGCTTTTTGCTCTTGGGATCACGGAAATGACGAACGTAACACGCCTCGGAGTGGATTGCGATGCTTTTAGTGTCTGCAAT
GGATACAATTGGGTCATCAGCTACCTCAACAGCCCGGGGAATCTCCCTCCGATTGGTGTTTTTCCTGATCAAATTATGATACAATCTCCTGGGCTAAGCC
TTACGTCTGCTACGGTTGCTAATGGCACGTATTTGGGTGGCGTTTTCAATTTGAAACTGGAATTACTGGACCCAGACACCAATCGAGCATATATTGGCAC
AACGTGGTGGCTTCCTGTCAATGTATCTGCCATTGGGATGGACGAAGCACTGGAGGCCTTAGATTTCGTTCGTTCGAACCGGGAGAAGGAGTATGACCCT
GAGACGAAAGGCTGGCGAGGGCTTAAGTTCGATACAGGCGTGCGAGTGTATCGGGAAGGACCGAATCTGGACGGAGGCCACACATGGAGGCTGGAGTGGG
CTCTAGAGAACTCCATGCGCTTTGCCGACCTGAAAATCACTTTGGATGTGTCTCGCATCACGCAGGAGATTGATCCGCTACCAGTTCCTTCGGAGCACGA
TTTACAGGGCAAACCGCGGTGTTCAGCCATCCCTAGTGCCATTTTCCAGCCGGATTTAACCGACCCTCTCGGCCTTCGTGGATACTGCGTGTATGCTATT
GCAAGCGAAACGACCCATGAACGACTTCTATGTAACTACACCGTGCTGAACCCGTGGATTGTTTTCACGCCTGAAAACTGGTGTATTCCCCAACAAGTTA
AGATTGAGGCGGTAGATGACTATCTGGATGAATACTCCACAGCGAACAGCTCGGTGACAGTCTCTAGCGTGACGCACAGGGTATTCAGTGACGACTACAA
CTACTTAACCCTTGCTCTTGCTGACGTAACGGTTAAAGTGGAAAGTGACGATGTGGCAAAAGTTTTAGTATCGGAATCTGCACTTATAGTGACTGAAGGC
AGGGACAGCAAAGCTCAGTACTTCATACACCTGAACTCGGAGCCTCTCGCGGATGTGAAGGTCACGGTTCTACCGTGGCTCGATGGGAACAATACGCAGT
GCTATCGCTTTGGCCTGTGCAACGTCACGCTCCCGGTTTCTGAGTTCGTCTTCACGCCTCGG